\
| Variant ID: vg0417576751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17576751 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATGTGAATTTGTTGTCACCATATATATCCCTCGTAATTTAATACATAATATATATTTGCTACACTGATTTCATATTTTTTTTCTTATATATATGTGATAA[G/A]
ATTAGAGATACAGAGTATCTTTTATGAAGATAGAGATGAACAGATAATGTTTGGTTTTCTAAAATTTAATTTTGTTAGCTTAATGGAAATATTTGATCAA
TTGATCAAATATTTCCATTAAGCTAACAAAATTAAATTTTAGAAAACCAAACATTATCTGTTCATCTCTATCTTCATAAAAGATACTCTGTATCTCTAAT[C/T]
TTATCACATATATATAAGAAAAAAAATATGAAATCAGTGTAGCAAATATATATTATGTATTAAATTACGAGGGATATATATGGTGACAACAAATTCACAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 74.70% | 25.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 57.20% | 42.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417576751 | G -> A | LOC_Os04g29560-LOC_Os04g29580 | intergenic_region ; MODIFIER | silent_mutation | Average:43.445; most accessible tissue: Zhenshan97 young leaf, score: 70.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417576751 | NA | 6.14E-06 | mr1066_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | NA | 1.22E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | NA | 5.68E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | NA | 1.88E-06 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | 6.39E-07 | NA | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | NA | 9.77E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | NA | 5.05E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417576751 | 3.77E-06 | 3.77E-06 | mr1770_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |