\
| Variant ID: vg0417551912 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17551912 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAGAGATATGATAGATCCGATCAAGCGCTGAGCTAGAACGGACTTACAGCGCTTTTCGTTACTCAGCTCATCATCACAGCATGTACACCTGCTCAGTGA[G/A]
CTGAGGGGACGACAAGGATAAACGTCTTCGTTGAATTGTAGCCCTTTTTGTTTTGACATTATAAGTCTACGACGACGATCGTCCTGAAAGCTAGGTCTAT
ATAGACCTAGCTTTCAGGACGATCGTCGTCGTAGACTTATAATGTCAAAACAAAAAGGGCTACAATTCAACGAAGACGTTTATCCTTGTCGTCCCCTCAG[C/T]
TCACTGAGCAGGTGTACATGCTGTGATGATGAGCTGAGTAACGAAAAGCGCTGTAAGTCCGTTCTAGCTCAGCGCTTGATCGGATCTATCATATCTCTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 4.80% | 1.52% | 33.96% | NA |
| All Indica | 2759 | 56.80% | 1.10% | 1.56% | 40.59% | NA |
| All Japonica | 1512 | 63.20% | 12.60% | 1.12% | 23.08% | NA |
| Aus | 269 | 61.30% | 0.00% | 2.97% | 35.69% | NA |
| Indica I | 595 | 78.30% | 0.20% | 1.01% | 20.50% | NA |
| Indica II | 465 | 55.50% | 4.50% | 1.29% | 38.71% | NA |
| Indica III | 913 | 38.40% | 0.30% | 1.86% | 59.36% | NA |
| Indica Intermediate | 786 | 62.50% | 0.60% | 1.78% | 35.11% | NA |
| Temperate Japonica | 767 | 59.70% | 0.30% | 1.04% | 38.98% | NA |
| Tropical Japonica | 504 | 61.50% | 36.10% | 1.79% | 0.60% | NA |
| Japonica Intermediate | 241 | 77.60% | 2.90% | 0.00% | 19.50% | NA |
| VI/Aromatic | 96 | 76.00% | 0.00% | 1.04% | 22.92% | NA |
| Intermediate | 90 | 70.00% | 6.70% | 3.33% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417551912 | G -> DEL | N | N | silent_mutation | Average:32.617; most accessible tissue: Callus, score: 71.449 | N | N | N | N |
| vg0417551912 | G -> A | LOC_Os04g29540.1 | upstream_gene_variant ; 2659.0bp to feature; MODIFIER | silent_mutation | Average:32.617; most accessible tissue: Callus, score: 71.449 | N | N | N | N |
| vg0417551912 | G -> A | LOC_Os04g29530-LOC_Os04g29540 | intergenic_region ; MODIFIER | silent_mutation | Average:32.617; most accessible tissue: Callus, score: 71.449 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417551912 | NA | 8.96E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | NA | 2.76E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | 2.43E-07 | 4.31E-10 | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | 6.36E-06 | 7.87E-09 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | NA | 9.20E-06 | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | NA | 1.12E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417551912 | NA | 2.11E-06 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |