Search for Variation information by Variation ID:
Detailed information for vg0417539277:
| Variant ID: vg0417539277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17539277 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CGCAAGGCTTTCGACCATGCGTCCGACCTACAGGAGACCTTCGACAACTTGCGTGCAGCGGGCATAAAACTGAATCCTGAGAAGTGCGTTTTCGGCGTTC[G/A]
TGCAGGCAAGCTGTTAGGCTTCCTTGTTTCTGAAAGAGGCATTGAGGCGAATCCCGAGAAAATCGATGCCATTCAGCAAATGAAGCCTCCGTCGAGCATA
Reverse complement sequence
TATGCTCGACGGAGGCTTCATTTGCTGAATGGCATCGATTTTCTCGGGATTCGCCTCAATGCCTCTTTCAGAAACAAGGAAGCCTAACAGCTTGCCTGCA[C/T]
GAACGCCGAAAACGCACTTCTCAGGATTCAGTTTTATGCCCGCTGCACGCAAGTTGTCGAAGGTCTCCTGTAGGTCGGACGCATGGTCGAAAGCCTTGCG
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 1.80% | 11.57% | 21.88% | NA |
| All Indica | 2759 | 55.10% | 3.10% | 17.94% | 23.92% | NA |
| All Japonica | 1512 | 78.20% | 0.00% | 1.85% | 19.97% | NA |
| Aus | 269 | 71.40% | 0.00% | 7.06% | 21.56% | NA |
| Indica I | 595 | 63.70% | 13.40% | 8.40% | 14.45% | NA |
| Indica II | 465 | 59.10% | 0.00% | 13.76% | 27.10% | NA |
| Indica III | 913 | 40.40% | 0.00% | 30.12% | 29.46% | NA |
| Indica Intermediate | 786 | 63.10% | 0.60% | 13.49% | 22.77% | NA |
| Temperate Japonica | 767 | 63.40% | 0.00% | 2.87% | 33.77% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.00% | 2.49% | 16.60% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 4.44% | 13.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417539277 | G -> DEL | LOC_Os04g29520.1 | N | frameshift_variant | Average:27.308; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | N | N | N | N |
| vg0417539277 | G -> A | LOC_Os04g29520.1 | missense_variant ; p.Arg235His; MODERATE | nonsynonymous_codon ; R235H | Average:27.308; most accessible tissue: Zhenshan97 flag leaf, score: 68.703 | benign  |
0.87 |
TOLERATED | 0.06 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417539277 | NA | 8.16E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417539277 | NA | 4.76E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417539277 | NA | 1.78E-07 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417539277 | 4.90E-07 | NA | mr1517_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417539277 | NA | 9.31E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417539277 | NA | 9.15E-08 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |