\
| Variant ID: vg0417526152 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17526152 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCAGTCGGAGCCGGCCAGCCGAATGCTATGGCCCAACCCCACGCACAAGCCGTGATTTCGCCCTTCGCCACGCCGTACCCGCAGCAAGGTGCGGTAAA[C/T]
AGGACGGGGGGCGAAAAGGGGCTACTACTGAGTGGGGGAATCAAGACTCGTCCAATCCCACCCCAGTTCAAATTCCCACCTGTCCCGCGCTATTCAGGCG
CGCCTGAATAGCGCGGGACAGGTGGGAATTTGAACTGGGGTGGGATTGGACGAGTCTTGATTCCCCCACTCAGTAGTAGCCCCTTTTCGCCCCCCGTCCT[G/A]
TTTACCGCACCTTGCTGCGGGTACGGCGTGGCGAAGGGCGAAATCACGGCTTGTGCGTGGGGTTGGGCCATAGCATTCGGCTGGCCGGCTCCGACTGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 1.30% | 11.15% | 18.45% | NA |
| All Indica | 2759 | 61.30% | 0.20% | 17.18% | 21.35% | NA |
| All Japonica | 1512 | 79.00% | 3.70% | 2.71% | 14.62% | NA |
| Aus | 269 | 81.00% | 0.00% | 2.97% | 15.99% | NA |
| Indica I | 595 | 82.50% | 0.00% | 6.22% | 11.26% | NA |
| Indica II | 465 | 61.10% | 0.40% | 17.20% | 21.29% | NA |
| Indica III | 913 | 42.40% | 0.40% | 28.92% | 28.26% | NA |
| Indica Intermediate | 786 | 67.20% | 0.00% | 11.83% | 20.99% | NA |
| Temperate Japonica | 767 | 69.60% | 1.40% | 3.65% | 25.29% | NA |
| Tropical Japonica | 504 | 95.20% | 4.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 74.70% | 10.40% | 4.56% | 10.37% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 84.40% | 1.10% | 3.33% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417526152 | C -> DEL | LOC_Os04g29469.1 | N | frameshift_variant | Average:32.385; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0417526152 | C -> T | LOC_Os04g29469.1 | synonymous_variant ; p.Asn2046Asn; LOW | synonymous_codon | Average:32.385; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417526152 | 8.78E-07 | 8.78E-07 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 4.48E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 1.25E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | 3.78E-06 | 2.60E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 3.06E-08 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 1.45E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | 6.98E-06 | 4.49E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | 2.82E-06 | 2.45E-07 | mr1246 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 3.53E-07 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 9.20E-07 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417526152 | NA | 8.30E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |