\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417526152:

Variant ID: vg0417526152 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17526152
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCAGTCGGAGCCGGCCAGCCGAATGCTATGGCCCAACCCCACGCACAAGCCGTGATTTCGCCCTTCGCCACGCCGTACCCGCAGCAAGGTGCGGTAAA[C/T]
AGGACGGGGGGCGAAAAGGGGCTACTACTGAGTGGGGGAATCAAGACTCGTCCAATCCCACCCCAGTTCAAATTCCCACCTGTCCCGCGCTATTCAGGCG

Reverse complement sequence

CGCCTGAATAGCGCGGGACAGGTGGGAATTTGAACTGGGGTGGGATTGGACGAGTCTTGATTCCCCCACTCAGTAGTAGCCCCTTTTCGCCCCCCGTCCT[G/A]
TTTACCGCACCTTGCTGCGGGTACGGCGTGGCGAAGGGCGAAATCACGGCTTGTGCGTGGGGTTGGGCCATAGCATTCGGCTGGCCGGCTCCGACTGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 1.30% 11.15% 18.45% NA
All Indica  2759 61.30% 0.20% 17.18% 21.35% NA
All Japonica  1512 79.00% 3.70% 2.71% 14.62% NA
Aus  269 81.00% 0.00% 2.97% 15.99% NA
Indica I  595 82.50% 0.00% 6.22% 11.26% NA
Indica II  465 61.10% 0.40% 17.20% 21.29% NA
Indica III  913 42.40% 0.40% 28.92% 28.26% NA
Indica Intermediate  786 67.20% 0.00% 11.83% 20.99% NA
Temperate Japonica  767 69.60% 1.40% 3.65% 25.29% NA
Tropical Japonica  504 95.20% 4.00% 0.40% 0.40% NA
Japonica Intermediate  241 74.70% 10.40% 4.56% 10.37% NA
VI/Aromatic  96 89.60% 0.00% 1.04% 9.38% NA
Intermediate  90 84.40% 1.10% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417526152 C -> DEL LOC_Os04g29469.1 N frameshift_variant Average:32.385; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0417526152 C -> T LOC_Os04g29469.1 synonymous_variant ; p.Asn2046Asn; LOW synonymous_codon Average:32.385; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417526152 8.78E-07 8.78E-07 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 4.48E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 1.25E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 3.78E-06 2.60E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 3.06E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 1.45E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 6.98E-06 4.49E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 2.82E-06 2.45E-07 mr1246 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 3.53E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 9.20E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417526152 NA 8.30E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251