\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417424147:

Variant ID: vg0417424147 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17424147
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTAATCGGACATTTTCTAGGAACTCCCACGTTAATTAGAAAAATCTGACCATTGATTACAAGATCCATATTATCATGACCATTGATTCAAGGATCTC[A/G]
CGGGCCACTTTATAAAGCCCATCACAACCATGCCCAAGGCCAATACGTTGTCTAATAGAGAGGAACGATATATATTATCCGATCTCCATATTAACCTCAA

Reverse complement sequence

TTGAGGTTAATATGGAGATCGGATAATATATATCGTTCCTCTCTATTAGACAACGTATTGGCCTTGGGCATGGTTGTGATGGGCTTTATAAAGTGGCCCG[T/C]
GAGATCCTTGAATCAATGGTCATGATAATATGGATCTTGTAATCAATGGTCAGATTTTTCTAATTAACGTGGGAGTTCCTAGAAAATGTCCGATTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 3.40% 1.04% 0.00% NA
All Indica  2759 92.50% 5.80% 1.63% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 85.40% 10.40% 4.20% 0.00% NA
Indica II  465 97.60% 1.50% 0.86% 0.00% NA
Indica III  913 93.40% 6.50% 0.11% 0.00% NA
Indica Intermediate  786 93.90% 4.20% 1.91% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417424147 A -> G LOC_Os04g29350.1 downstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:41.67; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0417424147 A -> G LOC_Os04g29330-LOC_Os04g29350 intergenic_region ; MODIFIER silent_mutation Average:41.67; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417424147 NA 6.98E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 4.46E-07 3.32E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 3.05E-08 1.16E-14 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 8.20E-08 2.18E-13 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 NA 1.87E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 NA 4.40E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 1.81E-06 1.00E-10 mr1864_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417424147 NA 6.77E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251