\
| Variant ID: vg0417424147 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17424147 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 49. )
ATACTAATCGGACATTTTCTAGGAACTCCCACGTTAATTAGAAAAATCTGACCATTGATTACAAGATCCATATTATCATGACCATTGATTCAAGGATCTC[A/G]
CGGGCCACTTTATAAAGCCCATCACAACCATGCCCAAGGCCAATACGTTGTCTAATAGAGAGGAACGATATATATTATCCGATCTCCATATTAACCTCAA
TTGAGGTTAATATGGAGATCGGATAATATATATCGTTCCTCTCTATTAGACAACGTATTGGCCTTGGGCATGGTTGTGATGGGCTTTATAAAGTGGCCCG[T/C]
GAGATCCTTGAATCAATGGTCATGATAATATGGATCTTGTAATCAATGGTCAGATTTTTCTAATTAACGTGGGAGTTCCTAGAAAATGTCCGATTAGTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 3.40% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 92.50% | 5.80% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.40% | 10.40% | 4.20% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 93.40% | 6.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.90% | 4.20% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417424147 | A -> G | LOC_Os04g29350.1 | downstream_gene_variant ; 1026.0bp to feature; MODIFIER | silent_mutation | Average:41.67; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0417424147 | A -> G | LOC_Os04g29330-LOC_Os04g29350 | intergenic_region ; MODIFIER | silent_mutation | Average:41.67; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417424147 | NA | 6.98E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | 4.46E-07 | 3.32E-11 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | 3.05E-08 | 1.16E-14 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | 8.20E-08 | 2.18E-13 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | NA | 1.87E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | NA | 4.40E-06 | mr1851_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | 1.81E-06 | 1.00E-10 | mr1864_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417424147 | NA | 6.77E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |