\
| Variant ID: vg0417375976 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17375976 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 36. )
TATTTGCTGATCCTTTGGGTTATGCATTAGTCGAGGAGTTCATGATACATGGCCCGTGTGGTGTAGACAATAAAACTTGCCCATGTATGAAAAAAGGTTC[G/C]
TGCTCTAAACATTTCCCTAAAACATTCCAAGCTGAAACAATACTTGATGAGTTTGGGTTAACTGTGTACAAGAGACGAGACGATGGTCGCTATGTAATTA
TAATTACATAGCGACCATCGTCTCGTCTCTTGTACACAGTTAACCCAAACTCATCAAGTATTGTTTCAGCTTGGAATGTTTTAGGGAAATGTTTAGAGCA[C/G]
GAACCTTTTTTCATACATGGGCAAGTTTTATTGTCTACACCACACGGGCCATGTATCATGAACTCCTCGACTAATGCATAACCCAAAGGATCAGCAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 3.30% | 4.97% | 7.98% | NA |
| All Indica | 2759 | 88.90% | 5.60% | 1.63% | 3.81% | NA |
| All Japonica | 1512 | 79.00% | 0.10% | 4.37% | 16.53% | NA |
| Aus | 269 | 59.10% | 0.00% | 37.92% | 2.97% | NA |
| Indica I | 595 | 70.90% | 11.10% | 3.03% | 14.96% | NA |
| Indica II | 465 | 97.60% | 1.50% | 0.65% | 0.22% | NA |
| Indica III | 913 | 92.40% | 5.60% | 1.20% | 0.77% | NA |
| Indica Intermediate | 786 | 93.40% | 3.90% | 1.65% | 1.02% | NA |
| Temperate Japonica | 767 | 65.10% | 0.00% | 6.78% | 28.16% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.40% | 4.98% | 13.28% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 19.79% | 10.42% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417375976 | G -> C | LOC_Os04g29310.1 | synonymous_variant ; p.Ser145Ser; LOW | synonymous_codon | Average:25.707; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| vg0417375976 | G -> DEL | LOC_Os04g29310.1 | N | frameshift_variant | Average:25.707; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417375976 | NA | 2.13E-07 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 2.59E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 4.73E-06 | mr1020_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | 5.05E-07 | 1.97E-14 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | 9.19E-08 | 1.59E-14 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 7.57E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 3.64E-06 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | 4.55E-06 | 6.99E-08 | mr1576_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 4.73E-09 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 2.89E-06 | mr1851_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 6.11E-10 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417375976 | NA | 9.67E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |