\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417345266:

Variant ID: vg0417345266 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17345266
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGCTGGATGTCCACTTCGTCCGGGAAAAGGTGGCCGTTGGGGACATACGCGTCGCGCACATTCCGACTCGACAACAACTCGCCGATATCATGACGAA[G/A]
CGATTGCCCACAGCGCTGTTTGAAGATTTCCGATCCAGTTTGTGCATCGTCGACGACGCACCAACTGCGGGGGGATGTCAAGATGGCTGATCATGTAGAT

Reverse complement sequence

ATCTACATGATCAGCCATCTTGACATCCCCCCGCAGTTGGTGCGTCGTCGACGATGCACAAACTGGATCGGAAATCTTCAAACAGCGCTGTGGGCAATCG[C/T]
TTCGTCATGATATCGGCGAGTTGTTGTCGAGTCGGAATGTGCGCGACGCGTATGTCCCCAACGGCCACCTTTTCCCGGACGAAGTGGACATCCAGCTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 1.50% 1.78% 6.24% NA
All Indica  2759 93.50% 2.50% 1.74% 2.21% NA
All Japonica  1512 84.90% 0.00% 1.52% 13.56% NA
Aus  269 97.40% 0.00% 0.37% 2.23% NA
Indica I  595 75.30% 10.80% 5.04% 8.91% NA
Indica II  465 99.60% 0.00% 0.22% 0.22% NA
Indica III  913 98.40% 0.00% 1.31% 0.33% NA
Indica Intermediate  786 98.20% 0.60% 0.64% 0.51% NA
Temperate Japonica  767 74.70% 0.00% 2.61% 22.69% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 86.70% 0.00% 1.24% 12.03% NA
VI/Aromatic  96 66.70% 0.00% 10.42% 22.92% NA
Intermediate  90 95.60% 1.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417345266 G -> DEL LOC_Os04g29250.1 N frameshift_variant Average:61.9; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N
vg0417345266 G -> A LOC_Os04g29250.1 synonymous_variant ; p.Lys513Lys; LOW synonymous_codon Average:61.9; most accessible tissue: Minghui63 flag leaf, score: 82.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417345266 NA 2.85E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417345266 NA 2.73E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417345266 NA 1.81E-07 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417345266 NA 9.03E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417345266 NA 5.03E-09 mr1543_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417345266 NA 7.78E-06 mr1742_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251