\
| Variant ID: vg0417345266 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17345266 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGAGCTGGATGTCCACTTCGTCCGGGAAAAGGTGGCCGTTGGGGACATACGCGTCGCGCACATTCCGACTCGACAACAACTCGCCGATATCATGACGAA[G/A]
CGATTGCCCACAGCGCTGTTTGAAGATTTCCGATCCAGTTTGTGCATCGTCGACGACGCACCAACTGCGGGGGGATGTCAAGATGGCTGATCATGTAGAT
ATCTACATGATCAGCCATCTTGACATCCCCCCGCAGTTGGTGCGTCGTCGACGATGCACAAACTGGATCGGAAATCTTCAAACAGCGCTGTGGGCAATCG[C/T]
TTCGTCATGATATCGGCGAGTTGTTGTCGAGTCGGAATGTGCGCGACGCGTATGTCCCCAACGGCCACCTTTTCCCGGACGAAGTGGACATCCAGCTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 1.50% | 1.78% | 6.24% | NA |
| All Indica | 2759 | 93.50% | 2.50% | 1.74% | 2.21% | NA |
| All Japonica | 1512 | 84.90% | 0.00% | 1.52% | 13.56% | NA |
| Aus | 269 | 97.40% | 0.00% | 0.37% | 2.23% | NA |
| Indica I | 595 | 75.30% | 10.80% | 5.04% | 8.91% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.22% | 0.22% | NA |
| Indica III | 913 | 98.40% | 0.00% | 1.31% | 0.33% | NA |
| Indica Intermediate | 786 | 98.20% | 0.60% | 0.64% | 0.51% | NA |
| Temperate Japonica | 767 | 74.70% | 0.00% | 2.61% | 22.69% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 86.70% | 0.00% | 1.24% | 12.03% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 10.42% | 22.92% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417345266 | G -> DEL | LOC_Os04g29250.1 | N | frameshift_variant | Average:61.9; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| vg0417345266 | G -> A | LOC_Os04g29250.1 | synonymous_variant ; p.Lys513Lys; LOW | synonymous_codon | Average:61.9; most accessible tissue: Minghui63 flag leaf, score: 82.975 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417345266 | NA | 2.85E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417345266 | NA | 2.73E-06 | mr1496_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417345266 | NA | 1.81E-07 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417345266 | NA | 9.03E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417345266 | NA | 5.03E-09 | mr1543_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417345266 | NA | 7.78E-06 | mr1742_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |