Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417276192:

Variant ID: vg0417276192 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17276192
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACAATCATTGAGGTAGATGATGCCGAAGAGCCGATGTAGTCGAATCGTGAAGGACGAGACGTCATACAGGGTTTGCCAGACCCCGGGACAACTCGGGAC[G/A]
AACGCGCGTGCTGGTGTTGCCAATACCGCGTGGGCGAGGTAGGGGACCACCATGAATCATACGCCAATGTCGGAGGAGACTAGCAGAGAAGGCCTGCGAG

Reverse complement sequence

CTCGCAGGCCTTCTCTGCTAGTCTCCTCCGACATTGGCGTATGATTCATGGTGGTCCCCTACCTCGCCCACGCGGTATTGGCAACACCAGCACGCGCGTT[C/T]
GTCCCGAGTTGTCCCGGGGTCTGGCAAACCCTGTATGACGTCTCGTCCTTCACGATTCGACTACATCGGCTCTTCGGCATCATCTACCTCAATGATTGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	1.90%	1.18%	0.00%	NA
All Indica	2759	94.90%	3.20%	1.92%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	78.70%	13.60%	7.73%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.60%	0.80%	0.64%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417276192	G -> A	LOC_Os04g29120.1	upstream_gene_variant ; 3801.0bp to feature; MODIFIER	silent_mutation	Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0417276192	G -> A	LOC_Os04g29100.1	downstream_gene_variant ; 3773.0bp to feature; MODIFIER	silent_mutation	Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N
vg0417276192	G -> A	LOC_Os04g29110.1	intron_variant ; MODIFIER	silent_mutation	Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417276192	NA	8.91E-06	mr1933	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	6.60E-06	9.68E-07	mr1245_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	NA	8.43E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	NA	5.26E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	NA	3.29E-07	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	NA	1.15E-06	mr1397_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	2.98E-06	2.98E-06	mr1417_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	NA	5.19E-06	mr1445_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	7.90E-06	7.90E-06	mr1674_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192	7.48E-06	7.48E-06	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251