\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417276192:

Variant ID: vg0417276192 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17276192
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACAATCATTGAGGTAGATGATGCCGAAGAGCCGATGTAGTCGAATCGTGAAGGACGAGACGTCATACAGGGTTTGCCAGACCCCGGGACAACTCGGGAC[G/A]
AACGCGCGTGCTGGTGTTGCCAATACCGCGTGGGCGAGGTAGGGGACCACCATGAATCATACGCCAATGTCGGAGGAGACTAGCAGAGAAGGCCTGCGAG

Reverse complement sequence

CTCGCAGGCCTTCTCTGCTAGTCTCCTCCGACATTGGCGTATGATTCATGGTGGTCCCCTACCTCGCCCACGCGGTATTGGCAACACCAGCACGCGCGTT[C/T]
GTCCCGAGTTGTCCCGGGGTCTGGCAAACCCTGTATGACGTCTCGTCCTTCACGATTCGACTACATCGGCTCTTCGGCATCATCTACCTCAATGATTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 1.90% 1.18% 0.00% NA
All Indica  2759 94.90% 3.20% 1.92% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 78.70% 13.60% 7.73% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 98.60% 0.80% 0.64% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417276192 G -> A LOC_Os04g29120.1 upstream_gene_variant ; 3801.0bp to feature; MODIFIER silent_mutation Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0417276192 G -> A LOC_Os04g29100.1 downstream_gene_variant ; 3773.0bp to feature; MODIFIER silent_mutation Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg0417276192 G -> A LOC_Os04g29110.1 intron_variant ; MODIFIER silent_mutation Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417276192 NA 8.91E-06 mr1933 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 6.60E-06 9.68E-07 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 NA 8.43E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 NA 5.26E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 NA 3.29E-07 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 NA 1.15E-06 mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 2.98E-06 2.98E-06 mr1417_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 NA 5.19E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 7.90E-06 7.90E-06 mr1674_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417276192 7.48E-06 7.48E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251