\
| Variant ID: vg0417276192 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17276192 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACAATCATTGAGGTAGATGATGCCGAAGAGCCGATGTAGTCGAATCGTGAAGGACGAGACGTCATACAGGGTTTGCCAGACCCCGGGACAACTCGGGAC[G/A]
AACGCGCGTGCTGGTGTTGCCAATACCGCGTGGGCGAGGTAGGGGACCACCATGAATCATACGCCAATGTCGGAGGAGACTAGCAGAGAAGGCCTGCGAG
CTCGCAGGCCTTCTCTGCTAGTCTCCTCCGACATTGGCGTATGATTCATGGTGGTCCCCTACCTCGCCCACGCGGTATTGGCAACACCAGCACGCGCGTT[C/T]
GTCCCGAGTTGTCCCGGGGTCTGGCAAACCCTGTATGACGTCTCGTCCTTCACGATTCGACTACATCGGCTCTTCGGCATCATCTACCTCAATGATTGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 1.90% | 1.18% | 0.00% | NA |
| All Indica | 2759 | 94.90% | 3.20% | 1.92% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 78.70% | 13.60% | 7.73% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 0.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417276192 | G -> A | LOC_Os04g29120.1 | upstream_gene_variant ; 3801.0bp to feature; MODIFIER | silent_mutation | Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0417276192 | G -> A | LOC_Os04g29100.1 | downstream_gene_variant ; 3773.0bp to feature; MODIFIER | silent_mutation | Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| vg0417276192 | G -> A | LOC_Os04g29110.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.157; most accessible tissue: Zhenshan97 young leaf, score: 88.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417276192 | NA | 8.91E-06 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | 6.60E-06 | 9.68E-07 | mr1245_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | NA | 8.43E-06 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | NA | 5.26E-06 | mr1332_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | NA | 3.29E-07 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | NA | 1.15E-06 | mr1397_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | 2.98E-06 | 2.98E-06 | mr1417_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | NA | 5.19E-06 | mr1445_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | 7.90E-06 | 7.90E-06 | mr1674_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417276192 | 7.48E-06 | 7.48E-06 | mr1764_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |