Variant ID: vg0417240491 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 17240491 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGTTGGCATGGGCAGTACTCTTAATGTTTCTTTCTTCCTTTGGCTTTATATATCTTATTATCTATTCAACGACAACTAAAATGATGAATGTTATTGTTT[A/C]
TTATTGCATAGGCTAGACTTGGAATAACATTTTGTGCTTTTATACCAGCTCATATACCGTCATATATACCTCTTTTCACGGTACTTTCTCTAGCAGAGGA
TCCTCTGCTAGAGAAAGTACCGTGAAAAGAGGTATATATGACGGTATATGAGCTGGTATAAAAGCACAAAATGTTATTCCAAGTCTAGCCTATGCAATAA[T/G]
AAACAATAACATTCATCATTTTAGTTGTCGTTGAATAGATAATAAGATATATAAAGCCAAAGGAAGAAAGAAACATTAAGAGTACTGCCCATGCCAACTT
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.70% | 3.70% | 1.46% | 3.11% | NA |
All Indica | 2759 | 97.60% | 0.40% | 0.87% | 1.09% | NA |
All Japonica | 1512 | 87.20% | 10.50% | 2.31% | 0.00% | NA |
Aus | 269 | 63.60% | 0.00% | 2.97% | 33.46% | NA |
Indica I | 595 | 97.60% | 0.00% | 2.35% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.30% | 0.22% | 0.43% | NA |
Indica III | 913 | 98.40% | 0.10% | 0.00% | 1.53% | NA |
Indica Intermediate | 786 | 96.40% | 0.60% | 1.15% | 1.78% | NA |
Temperate Japonica | 767 | 95.20% | 2.10% | 2.74% | 0.00% | NA |
Tropical Japonica | 504 | 70.00% | 27.60% | 2.38% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 70.80% | 0.00% | 1.04% | 28.12% | NA |
Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0417240491 | A -> C | LOC_Os04g29080.1 | downstream_gene_variant ; 3109.0bp to feature; MODIFIER | silent_mutation | Average:40.728; most accessible tissue: Callus, score: 71.88 | N | N | N | N |
vg0417240491 | A -> C | LOC_Os04g29080-LOC_Os04g29090 | intergenic_region ; MODIFIER | silent_mutation | Average:40.728; most accessible tissue: Callus, score: 71.88 | N | N | N | N |
vg0417240491 | A -> DEL | N | N | silent_mutation | Average:40.728; most accessible tissue: Callus, score: 71.88 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0417240491 | 2.86E-06 | NA | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417240491 | 9.45E-08 | NA | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417240491 | NA | 9.22E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417240491 | 2.99E-06 | NA | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |