\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417238354:

Variant ID: vg0417238354 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17238354
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGCCAGCAACGTTGCTGGCGCGTGCACGCGAATTAGCCACGCCACTCTAGACGCCATGCTTACACATCCTGCCGAGCAGCAGGCTGGGCCGAGTAGTG[T/C]
GCGGATGGACGAGGCTTGCAGGTTTGTCGACATGGGGTCCAATATTTGTCGACATGGAGTCTCATGTGTCTTATGGTATTCTGATATCTCTCATCTCGTG

Reverse complement sequence

CACGAGATGAGAGATATCAGAATACCATAAGACACATGAGACTCCATGTCGACAAATATTGGACCCCATGTCGACAAACCTGCAAGCCTCGTCCATCCGC[A/G]
CACTACTCGGCCCAGCCTGCTGCTCGGCAGGATGTGTAAGCATGGCGTCTAGAGTGGCGTGGCTAATTCGCGTGCACGCGCCAGCAACGTTGCTGGCGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.50% 7.20% 2.90% 1.44% NA
All Indica  2759 97.20% 0.60% 1.70% 0.51% NA
All Japonica  1512 78.60% 20.20% 1.12% 0.00% NA
Aus  269 62.10% 0.00% 17.84% 20.07% NA
Indica I  595 98.00% 0.00% 2.02% 0.00% NA
Indica II  465 95.90% 3.00% 1.08% 0.00% NA
Indica III  913 97.90% 0.20% 0.99% 0.88% NA
Indica Intermediate  786 96.40% 0.10% 2.67% 0.76% NA
Temperate Japonica  767 96.10% 3.10% 0.78% 0.00% NA
Tropical Japonica  504 50.00% 48.60% 1.39% 0.00% NA
Japonica Intermediate  241 83.00% 15.40% 1.66% 0.00% NA
VI/Aromatic  96 74.00% 0.00% 26.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417238354 T -> C LOC_Os04g29080.1 downstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0417238354 T -> C LOC_Os04g29080-LOC_Os04g29090 intergenic_region ; MODIFIER silent_mutation Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0417238354 T -> DEL N N silent_mutation Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417238354 4.28E-30 2.97E-55 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 5.07E-11 9.31E-30 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 4.73E-29 2.80E-43 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 2.12E-10 4.99E-23 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 NA 2.85E-11 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 4.02E-06 2.75E-11 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 NA 3.20E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 NA 9.62E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 NA 3.16E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 3.02E-28 2.48E-57 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 8.30E-08 2.96E-29 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 1.55E-26 2.34E-43 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 1.99E-07 2.18E-21 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 3.32E-11 3.43E-23 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417238354 1.09E-06 5.52E-16 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251