\
| Variant ID: vg0417238354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17238354 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGCGCCAGCAACGTTGCTGGCGCGTGCACGCGAATTAGCCACGCCACTCTAGACGCCATGCTTACACATCCTGCCGAGCAGCAGGCTGGGCCGAGTAGTG[T/C]
GCGGATGGACGAGGCTTGCAGGTTTGTCGACATGGGGTCCAATATTTGTCGACATGGAGTCTCATGTGTCTTATGGTATTCTGATATCTCTCATCTCGTG
CACGAGATGAGAGATATCAGAATACCATAAGACACATGAGACTCCATGTCGACAAATATTGGACCCCATGTCGACAAACCTGCAAGCCTCGTCCATCCGC[A/G]
CACTACTCGGCCCAGCCTGCTGCTCGGCAGGATGTGTAAGCATGGCGTCTAGAGTGGCGTGGCTAATTCGCGTGCACGCGCCAGCAACGTTGCTGGCGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 7.20% | 2.90% | 1.44% | NA |
| All Indica | 2759 | 97.20% | 0.60% | 1.70% | 0.51% | NA |
| All Japonica | 1512 | 78.60% | 20.20% | 1.12% | 0.00% | NA |
| Aus | 269 | 62.10% | 0.00% | 17.84% | 20.07% | NA |
| Indica I | 595 | 98.00% | 0.00% | 2.02% | 0.00% | NA |
| Indica II | 465 | 95.90% | 3.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 97.90% | 0.20% | 0.99% | 0.88% | NA |
| Indica Intermediate | 786 | 96.40% | 0.10% | 2.67% | 0.76% | NA |
| Temperate Japonica | 767 | 96.10% | 3.10% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 50.00% | 48.60% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 15.40% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 26.04% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417238354 | T -> C | LOC_Os04g29080.1 | downstream_gene_variant ; 972.0bp to feature; MODIFIER | silent_mutation | Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| vg0417238354 | T -> C | LOC_Os04g29080-LOC_Os04g29090 | intergenic_region ; MODIFIER | silent_mutation | Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| vg0417238354 | T -> DEL | N | N | silent_mutation | Average:52.456; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417238354 | 4.28E-30 | 2.97E-55 | mr1301 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 5.07E-11 | 9.31E-30 | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 4.73E-29 | 2.80E-43 | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 2.12E-10 | 4.99E-23 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | NA | 2.85E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 4.02E-06 | 2.75E-11 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | NA | 3.20E-09 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | NA | 9.62E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | NA | 3.16E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 3.02E-28 | 2.48E-57 | mr1301_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 8.30E-08 | 2.96E-29 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 1.55E-26 | 2.34E-43 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 1.99E-07 | 2.18E-21 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 3.32E-11 | 3.43E-23 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417238354 | 1.09E-06 | 5.52E-16 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |