Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417168943:

Variant ID: vg0417168943 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17168943
Reference Allele: A	Alternative Allele: T,G
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTCTTTTCCTTTGCCTCACTAGATCAATTGGTTCTCCATTAAGTAGTGAGTCAGGGGCTACATTATATCTTTTTTTTCAACAATTTTCATAATATTT[A/T,G]
TCTTGATTGCTTGTGAAATAATCAAATTAAAAATACCTATCGAGTTATGGAGCTCTATATCCCTATGTTTTCCGTTTGGTTTATCAATGGATAGTTGCTT

Reverse complement sequence

AAGCAACTATCCATTGATAAACCAAACGGAAAACATAGGGATATAGAGCTCCATAACTCGATAGGTATTTTTAATTTGATTATTTCACAAGCAATCAAGA[T/A,C]
AAATATTATGAAAATTGTTGAAAAAAAAGATATAATGTAGCCCCTGACTCACTACTTAATGGAGAACCAATTGATCTAGTGAGGCAAAGGAAAAGAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	6.60%	1.67%	0.00%	G: 0.72%
All Indica	2759	98.20%	0.60%	0.83%	0.00%	G: 0.36%
All Japonica	1512	78.40%	18.10%	3.51%	0.00%	G: 0.07%
Aus	269	97.00%	0.00%	0.00%	0.00%	G: 2.97%
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	96.30%	2.80%	0.86%	0.00%	NA
Indica III	913	98.80%	0.20%	0.22%	0.00%	G: 0.77%
Indica Intermediate	786	98.20%	0.30%	1.15%	0.00%	G: 0.38%
Temperate Japonica	767	94.40%	2.50%	3.13%	0.00%	NA
Tropical Japonica	504	53.20%	42.50%	4.17%	0.00%	G: 0.20%
Japonica Intermediate	241	80.10%	16.60%	3.32%	0.00%	NA
VI/Aromatic	96	69.80%	14.60%	0.00%	0.00%	G: 15.62%
Intermediate	90	85.60%	11.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417168943	A -> G	LOC_Os04g28970.1	downstream_gene_variant ; 4471.0bp to feature; MODIFIER	silent_mutation	Average:42.626; most accessible tissue: Callus, score: 58.355	N	N	N	N
vg0417168943	A -> G	LOC_Os04g28940-LOC_Os04g28970	intergenic_region ; MODIFIER	silent_mutation	Average:42.626; most accessible tissue: Callus, score: 58.355	N	N	N	N
vg0417168943	A -> T	LOC_Os04g28970.1	downstream_gene_variant ; 4471.0bp to feature; MODIFIER	silent_mutation	Average:42.626; most accessible tissue: Callus, score: 58.355	N	N	N	N
vg0417168943	A -> T	LOC_Os04g28940-LOC_Os04g28970	intergenic_region ; MODIFIER	silent_mutation	Average:42.626; most accessible tissue: Callus, score: 58.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417168943	1.44E-22	2.78E-36	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	6.48E-11	6.04E-22	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	6.93E-23	2.84E-31	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	1.61E-09	1.83E-19	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	NA	2.39E-09	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	NA	1.84E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	1.04E-25	7.19E-44	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	2.75E-12	8.99E-25	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	3.36E-22	1.59E-34	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	9.11E-09	1.05E-20	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	7.07E-12	3.13E-21	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417168943	1.51E-08	4.60E-16	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251