Variant ID: vg0417132051 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 17132051 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCGTATCACACTACTACAGAAAACACATACAGTTCAATACTATATGTGCCGGAACAGTTAAAACCAATAACTACAGATCTCTTCCCACCTTTGCATGGTG[A/G]
AAAAAATAAAATAAAATCGACACCTTTTACCAACTATAGGTGTTAGTTCTAAAGAAAAACCAGCACCAACACTTTTAAGTCCCATTTTTTTAACAAAACG
CGTTTTGTTAAAAAAATGGGACTTAAAAGTGTTGGTGCTGGTTTTTCTTTAGAACTAACACCTATAGTTGGTAAAAGGTGTCGATTTTATTTTATTTTTT[T/C]
CACCATGCAAAGGTGGGAAGAGATCTGTAGTTATTGGTTTTAACTGTTCCGGCACATATAGTATTGAACTGTATGTGTTTTCTGTAGTAGTGTGATACGC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.70% | 9.50% | 3.58% | 1.21% | NA |
All Indica | 2759 | 96.00% | 1.10% | 2.46% | 0.36% | NA |
All Japonica | 1512 | 66.50% | 27.10% | 6.08% | 0.33% | NA |
Aus | 269 | 96.30% | 0.00% | 0.74% | 2.97% | NA |
Indica I | 595 | 94.60% | 0.20% | 5.21% | 0.00% | NA |
Indica II | 465 | 95.50% | 2.60% | 1.51% | 0.43% | NA |
Indica III | 913 | 98.00% | 1.00% | 0.44% | 0.55% | NA |
Indica Intermediate | 786 | 95.20% | 1.10% | 3.31% | 0.38% | NA |
Temperate Japonica | 767 | 64.80% | 26.90% | 7.95% | 0.39% | NA |
Tropical Japonica | 504 | 59.50% | 36.30% | 3.97% | 0.20% | NA |
Japonica Intermediate | 241 | 86.70% | 8.30% | 4.56% | 0.41% | NA |
VI/Aromatic | 96 | 65.60% | 0.00% | 0.00% | 34.38% | NA |
Intermediate | 90 | 78.90% | 12.20% | 7.78% | 1.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0417132051 | A -> DEL | N | N | silent_mutation | Average:60.719; most accessible tissue: Callus, score: 90.106 | N | N | N | N |
vg0417132051 | A -> G | LOC_Os04g28900.1 | upstream_gene_variant ; 3723.0bp to feature; MODIFIER | silent_mutation | Average:60.719; most accessible tissue: Callus, score: 90.106 | N | N | N | N |
vg0417132051 | A -> G | LOC_Os04g28910.1 | upstream_gene_variant ; 4853.0bp to feature; MODIFIER | silent_mutation | Average:60.719; most accessible tissue: Callus, score: 90.106 | N | N | N | N |
vg0417132051 | A -> G | LOC_Os04g28900-LOC_Os04g28910 | intergenic_region ; MODIFIER | silent_mutation | Average:60.719; most accessible tissue: Callus, score: 90.106 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0417132051 | 1.74E-08 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | 5.30E-07 | NA | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | NA | 6.25E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | 3.60E-10 | NA | mr1301_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | 9.45E-07 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | 1.09E-06 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | NA | 1.30E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0417132051 | NA | 7.58E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |