\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417123204:

Variant ID: vg0417123204 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17123204
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGAAATTATCTCACTACTTTCAAAGTCACCCGGTCACGGTAGTCATATCGTTTCCACTCGGGGATATACTTCATAACCGCGAAGCAAACGGACGGATC[G/A]
CGAAATGGGCCTTAGAATTGATGTCTTTGGAAGTATCGTTCAAGCCACGAACTTCGATCAAGTCACAAGCTTTAGCTGATTTCCTTGCCGAGTGGACCGA

Reverse complement sequence

TCGGTCCACTCGGCAAGGAAATCAGCTAAAGCTTGTGACTTGATCGAAGTTCGTGGCTTGAACGATACTTCCAAAGACATCAATTCTAAGGCCCATTTCG[C/T]
GATCCGTCCGTTTGCTTCGCGGTTATGAAGTATATCCCCGAGTGGAAACGATATGACTACCGTGACCGGGTGACTTTGAAAGTAGTGAGATAATTTCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 12.20% 3.22% 0.00% NA
All Indica  2759 95.80% 1.90% 2.28% 0.00% NA
All Japonica  1512 67.10% 27.70% 5.16% 0.00% NA
Aus  269 63.20% 34.60% 2.23% 0.00% NA
Indica I  595 94.50% 0.20% 5.38% 0.00% NA
Indica II  465 95.70% 3.00% 1.29% 0.00% NA
Indica III  913 97.40% 2.20% 0.44% 0.00% NA
Indica Intermediate  786 95.20% 2.20% 2.67% 0.00% NA
Temperate Japonica  767 66.00% 27.80% 6.26% 0.00% NA
Tropical Japonica  504 59.30% 36.70% 3.97% 0.00% NA
Japonica Intermediate  241 87.10% 8.70% 4.15% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 82.20% 13.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417123204 G -> A LOC_Os04g28880.1 missense_variant ; p.Ala1403Thr; MODERATE nonsynonymous_codon ; A1403M Average:33.312; most accessible tissue: Minghui63 young leaf, score: 55.178 probably damaging 2.86 DELETERIOUS 0.00
vg0417123204 G -> A LOC_Os04g28880.1 missense_variant ; p.Ala1403Thr; MODERATE nonsynonymous_codon ; A1403T Average:33.312; most accessible tissue: Minghui63 young leaf, score: 55.178 benign 0.73 TOLERATED 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417123204 2.07E-08 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417123204 9.91E-07 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417123204 6.02E-09 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417123204 6.95E-07 NA mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417123204 NA 1.44E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417123204 4.02E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251