\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417121176:

Variant ID: vg0417121176 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17121176
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCCCGATTGGTTTTCAAGATCATCGCAAAGAACTTAATCACATCTTCGGCGGACCCCTGGCTTATGAATCTAAGAGAAAACAGAAGCTAACAGAACGG[G/C]
AGATCAATGCGGTTCAGCCTAACACGCCCCAATATCTTCGGTGGTCAGAGATAGTAATTAAGTTCGATAGATCGGATCATCCCGACCGAGTGGTCCACCC

Reverse complement sequence

GGGTGGACCACTCGGTCGGGATGATCCGATCTATCGAACTTAATTACTATCTCTGACCACCGAAGATATTGGGGCGTGTTAGGCTGAACCGCATTGATCT[C/G]
CCGTTCTGTTAGCTTCTGTTTTCTCTTAGATTCATAAGCCAGGGGTCCGCCGAAGATGTGATTAAGTTCTTTGCGATGATCTTGAAAACCAATCGGGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 6.30% 2.39% 0.21% NA
All Indica  2759 97.80% 0.50% 1.63% 0.04% NA
All Japonica  1512 78.80% 17.30% 3.90% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 96.30% 0.00% 3.70% 0.00% NA
Indica II  465 95.50% 2.20% 2.37% 0.00% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 98.20% 0.30% 1.53% 0.00% NA
Temperate Japonica  767 94.80% 2.30% 2.87% 0.00% NA
Tropical Japonica  504 54.80% 40.90% 4.37% 0.00% NA
Japonica Intermediate  241 78.40% 15.40% 6.22% 0.00% NA
VI/Aromatic  96 75.00% 12.50% 3.12% 9.38% NA
Intermediate  90 84.40% 11.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417121176 G -> C LOC_Os04g28880.1 missense_variant ; p.Glu780Gln; MODERATE nonsynonymous_codon ; E780Q Average:44.532; most accessible tissue: Minghui63 young leaf, score: 75.479 possibly damaging 1.843 DELETERIOUS 0.00
vg0417121176 G -> DEL LOC_Os04g28880.1 N frameshift_variant Average:44.532; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417121176 3.93E-21 2.02E-35 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 1.73E-10 8.96E-24 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 5.15E-23 2.02E-31 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 2.83E-10 3.30E-22 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 1.76E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 6.36E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 6.37E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 7.12E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 7.66E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 8.29E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 NA 7.21E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 1.94E-25 4.22E-44 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 1.46E-10 3.78E-30 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 3.19E-25 2.54E-36 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 2.43E-10 1.29E-25 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 4.59E-10 3.89E-20 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417121176 6.53E-09 1.97E-18 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251