\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417021326:

Variant ID: vg0417021326 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 17021326
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGTGGTATATTATTGTTCTAACATAAATATGCATTGCAAGCATAACTAGTTCTCCTCTATTTTGGTAGTATTGACGGTCGAAACTAATCGCTAACGAC[C/T]
GTCAACAAAACCCCCAAAGCTTGAACCTTTGCTCATCCTGAGTAAAGTACGAAAGGAAACAAAGACTTGGTTGTTAATCAGGAGTTGCTAGTATGCTGTA

Reverse complement sequence

TACAGCATACTAGCAACTCCTGATTAACAACCAAGTCTTTGTTTCCTTTCGTACTTTACTCAGGATGAGCAAAGGTTCAAGCTTTGGGGGTTTTGTTGAC[G/A]
GTCGTTAGCGATTAGTTTCGACCGTCAATACTACCAAAATAGAGGAGAACTAGTTATGCTTGCAATGCATATTTATGTTAGAACAATAATATACCACTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 15.50% 5.23% 0.00% NA
All Indica  2759 84.30% 10.60% 5.07% 0.00% NA
All Japonica  1512 66.80% 27.20% 5.95% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 81.70% 7.40% 10.92% 0.00% NA
Indica II  465 58.30% 34.40% 7.31% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 84.10% 10.90% 4.96% 0.00% NA
Temperate Japonica  767 90.40% 3.30% 6.39% 0.00% NA
Tropical Japonica  504 31.50% 65.10% 3.37% 0.00% NA
Japonica Intermediate  241 65.60% 24.50% 9.96% 0.00% NA
VI/Aromatic  96 88.50% 6.20% 5.21% 0.00% NA
Intermediate  90 66.70% 22.20% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0417021326 C -> T LOC_Os04g28730.1 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0417021326 C -> T LOC_Os04g28720.1 downstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0417021326 C -> T LOC_Os04g28740.1 downstream_gene_variant ; 842.0bp to feature; MODIFIER silent_mutation Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0417021326 C -> T LOC_Os04g28750.1 downstream_gene_variant ; 3898.0bp to feature; MODIFIER silent_mutation Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0417021326 C -> T LOC_Os04g28730-LOC_Os04g28740 intergenic_region ; MODIFIER silent_mutation Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0417021326 NA 2.14E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 4.29E-12 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.12E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.17E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.57E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 5.20E-14 mr1235 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.65E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 4.46E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.42E-12 mr1251 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.56E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 4.95E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 2.52E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 5.77E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.91E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.13E-09 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.10E-12 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 5.75E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.31E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 8.71E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.75E-07 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.65E-06 mr1689 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.46E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.04E-08 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 5.15E-15 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.65E-11 mr1784 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.52E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 6.55E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 9.78E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 2.87E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.14E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 8.04E-07 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 7.72E-21 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 3.81E-09 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.00E-17 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 1.31E-16 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 6.89E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 NA 4.26E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326 2.89E-07 1.12E-18 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251