| Variant ID: vg0417021326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 17021326 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
CTAGTGGTATATTATTGTTCTAACATAAATATGCATTGCAAGCATAACTAGTTCTCCTCTATTTTGGTAGTATTGACGGTCGAAACTAATCGCTAACGAC[C/T]
GTCAACAAAACCCCCAAAGCTTGAACCTTTGCTCATCCTGAGTAAAGTACGAAAGGAAACAAAGACTTGGTTGTTAATCAGGAGTTGCTAGTATGCTGTA
TACAGCATACTAGCAACTCCTGATTAACAACCAAGTCTTTGTTTCCTTTCGTACTTTACTCAGGATGAGCAAAGGTTCAAGCTTTGGGGGTTTTGTTGAC[G/A]
GTCGTTAGCGATTAGTTTCGACCGTCAATACTACCAAAATAGAGGAGAACTAGTTATGCTTGCAATGCATATTTATGTTAGAACAATAATATACCACTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.30% | 15.50% | 5.23% | 0.00% | NA |
| All Indica | 2759 | 84.30% | 10.60% | 5.07% | 0.00% | NA |
| All Japonica | 1512 | 66.80% | 27.20% | 5.95% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 81.70% | 7.40% | 10.92% | 0.00% | NA |
| Indica II | 465 | 58.30% | 34.40% | 7.31% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.10% | 10.90% | 4.96% | 0.00% | NA |
| Temperate Japonica | 767 | 90.40% | 3.30% | 6.39% | 0.00% | NA |
| Tropical Japonica | 504 | 31.50% | 65.10% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 24.50% | 9.96% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 6.20% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 22.20% | 11.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0417021326 | C -> T | LOC_Os04g28730.1 | upstream_gene_variant ; 185.0bp to feature; MODIFIER | silent_mutation | Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0417021326 | C -> T | LOC_Os04g28720.1 | downstream_gene_variant ; 4293.0bp to feature; MODIFIER | silent_mutation | Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0417021326 | C -> T | LOC_Os04g28740.1 | downstream_gene_variant ; 842.0bp to feature; MODIFIER | silent_mutation | Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0417021326 | C -> T | LOC_Os04g28750.1 | downstream_gene_variant ; 3898.0bp to feature; MODIFIER | silent_mutation | Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0417021326 | C -> T | LOC_Os04g28730-LOC_Os04g28740 | intergenic_region ; MODIFIER | silent_mutation | Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0417021326 | NA | 2.14E-10 | mr1089 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 4.29E-12 | mr1093 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 1.12E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 1.17E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 1.57E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 5.20E-14 | mr1235 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 3.65E-12 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 4.46E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 1.42E-12 | mr1251 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0417021326 | NA | 1.56E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/