Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0417021326:

Variant ID: vg0417021326 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 17021326
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGTGGTATATTATTGTTCTAACATAAATATGCATTGCAAGCATAACTAGTTCTCCTCTATTTTGGTAGTATTGACGGTCGAAACTAATCGCTAACGAC[C/T]
GTCAACAAAACCCCCAAAGCTTGAACCTTTGCTCATCCTGAGTAAAGTACGAAAGGAAACAAAGACTTGGTTGTTAATCAGGAGTTGCTAGTATGCTGTA

Reverse complement sequence

TACAGCATACTAGCAACTCCTGATTAACAACCAAGTCTTTGTTTCCTTTCGTACTTTACTCAGGATGAGCAAAGGTTCAAGCTTTGGGGGTTTTGTTGAC[G/A]
GTCGTTAGCGATTAGTTTCGACCGTCAATACTACCAAAATAGAGGAGAACTAGTTATGCTTGCAATGCATATTTATGTTAGAACAATAATATACCACTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	15.50%	5.23%	0.00%	NA
All Indica	2759	84.30%	10.60%	5.07%	0.00%	NA
All Japonica	1512	66.80%	27.20%	5.95%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	81.70%	7.40%	10.92%	0.00%	NA
Indica II	465	58.30%	34.40%	7.31%	0.00%	NA
Indica III	913	99.50%	0.30%	0.22%	0.00%	NA
Indica Intermediate	786	84.10%	10.90%	4.96%	0.00%	NA
Temperate Japonica	767	90.40%	3.30%	6.39%	0.00%	NA
Tropical Japonica	504	31.50%	65.10%	3.37%	0.00%	NA
Japonica Intermediate	241	65.60%	24.50%	9.96%	0.00%	NA
VI/Aromatic	96	88.50%	6.20%	5.21%	0.00%	NA
Intermediate	90	66.70%	22.20%	11.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0417021326	C -> T	LOC_Os04g28730.1	upstream_gene_variant ; 185.0bp to feature; MODIFIER	silent_mutation	Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0417021326	C -> T	LOC_Os04g28720.1	downstream_gene_variant ; 4293.0bp to feature; MODIFIER	silent_mutation	Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0417021326	C -> T	LOC_Os04g28740.1	downstream_gene_variant ; 842.0bp to feature; MODIFIER	silent_mutation	Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0417021326	C -> T	LOC_Os04g28750.1	downstream_gene_variant ; 3898.0bp to feature; MODIFIER	silent_mutation	Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg0417021326	C -> T	LOC_Os04g28730-LOC_Os04g28740	intergenic_region ; MODIFIER	silent_mutation	Average:40.577; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0417021326	NA	2.14E-10	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	4.29E-12	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.12E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.17E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.57E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	5.20E-14	mr1235	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.65E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	4.46E-06	mr1246	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.42E-12	mr1251	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.56E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	4.95E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	2.52E-16	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	5.77E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.91E-14	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.13E-09	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.10E-12	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	5.75E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.31E-10	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	8.71E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.75E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.65E-06	mr1689	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.46E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.04E-08	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	5.15E-15	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.65E-11	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.52E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	6.55E-07	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	9.78E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	2.87E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.14E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	8.04E-07	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	7.72E-21	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	3.81E-09	mr1364_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.00E-17	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	1.31E-16	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	6.89E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	NA	4.26E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0417021326	2.89E-07	1.12E-18	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251