Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416954498:

Variant ID: vg0416954498 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16954498
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TACCACTATATGAAATTACTTAATCTCTAATTCAAAATATAACAACATGAAATGATAGCCATAAGTTAAATAATACAGAGAGATGCCATTTTTTATTTTT[A/G]
TTTTATTTTTTTGATATTTTTTTCACACTTCGGAGAATACAAGAACCAACCATAGAAAAAATAAACTCAAACGGACAAAATATGTGACTTGTAGAATTTT

Reverse complement sequence

AAAATTCTACAAGTCACATATTTTGTCCGTTTGAGTTTATTTTTTCTATGGTTGGTTCTTGTATTCTCCGAAGTGTGAAAAAAATATCAAAAAAATAAAA[T/C]
AAAAATAAAAAATGGCATCTCTCTGTATTATTTAACTTATGGCTATCATTTCATGTTGTTATATTTTGAATTAGAGATTAAGTAATTTCATATAGTGGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 1.40% 0.28% 3.49% NA
All Indica  2759 95.70% 2.40% 0.47% 1.45% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 54.60% 0.00% 0.00% 45.35% NA
Indica I  595 92.80% 6.10% 1.18% 0.00% NA
Indica II  465 98.10% 1.10% 0.22% 0.65% NA
Indica III  913 98.10% 0.00% 0.11% 1.75% NA
Indica Intermediate  786 93.50% 3.30% 0.51% 2.67% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416954498 A -> DEL N N silent_mutation Average:29.902; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg0416954498 A -> G LOC_Os04g28620.1 downstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:29.902; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N
vg0416954498 A -> G LOC_Os04g28630.1 intron_variant ; MODIFIER silent_mutation Average:29.902; most accessible tissue: Minghui63 flag leaf, score: 41.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416954498 NA 7.94E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 9.30E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 1.49E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 5.88E-06 3.26E-06 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 5.98E-06 5.48E-08 mr1616_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 3.96E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 8.00E-06 7.99E-06 mr1651_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 2.10E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 2.05E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 4.15E-06 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416954498 NA 1.69E-09 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251