\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416878791:

Variant ID: vg0416878791 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 16878791
Reference Allele: CAlternative Allele: T,CAA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGAGGCTTCGGATCGTTCTCACCCTCACCACTTGGTCGCATCCGACCTTGGCAGGTATAAAGCTAGTTATCCTCTTGCTGCTCGCAGCTAGTTACCCT[C/T,CAA]
TTGTTTTCGGTTTACACCGGCGCTCTTTTGTCTTGAACCTACTGCCGTGAAGATCGGGCCACCCCTCGTGAGTGTATTCGCATCACGTTTGAAGTCAGCC

Reverse complement sequence

GGCTGACTTCAAACGTGATGCGAATACACTCACGAGGGGTGGCCCGATCTTCACGGCAGTAGGTTCAAGACAAAAGAGCGCCGGTGTAAACCGAAAACAA[G/A,TTG]
AGGGTAACTAGCTGCGAGCAGCAAGAGGATAACTAGCTTTATACCTGCCAAGGTCGGATGCGACCAAGTGGTGAGGGTGAGAACGATCCGAAGCCTCCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 5.40% 4.85% 0.00% NA
All Indica  2759 94.30% 2.20% 3.52% 0.00% NA
All Japonica  1512 79.20% 12.60% 8.13% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 84.20% 5.70% 10.08% 0.00% NA
Indica II  465 97.00% 0.00% 3.01% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 94.70% 2.50% 2.80% 0.00% NA
Temperate Japonica  767 70.70% 17.10% 12.26% 0.00% NA
Tropical Japonica  504 94.20% 3.40% 2.38% 0.00% NA
Japonica Intermediate  241 75.10% 17.80% 7.05% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 3.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416878791 C -> CAA LOC_Os04g28520.1 upstream_gene_variant ; 3860.0bp to feature; MODIFIER N Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> CAA LOC_Os04g28520.2 upstream_gene_variant ; 3860.0bp to feature; MODIFIER N Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> CAA LOC_Os04g28490.1 downstream_gene_variant ; 2023.0bp to feature; MODIFIER N Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> CAA LOC_Os04g28500.1 downstream_gene_variant ; 786.0bp to feature; MODIFIER N Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> CAA LOC_Os04g28500-LOC_Os04g28520 intergenic_region ; MODIFIER N Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> T LOC_Os04g28520.1 upstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> T LOC_Os04g28520.2 upstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> T LOC_Os04g28490.1 downstream_gene_variant ; 2022.0bp to feature; MODIFIER silent_mutation Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> T LOC_Os04g28500.1 downstream_gene_variant ; 785.0bp to feature; MODIFIER silent_mutation Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N
vg0416878791 C -> T LOC_Os04g28500-LOC_Os04g28520 intergenic_region ; MODIFIER silent_mutation Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416878791 NA 9.05E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 3.87E-08 2.27E-12 mr1070 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 1.23E-07 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 4.70E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 2.57E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 7.72E-07 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 7.49E-07 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 3.84E-11 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 2.17E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 2.04E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 3.36E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 7.29E-06 7.79E-10 mr1204_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 4.49E-06 4.50E-06 mr1260_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 2.45E-06 mr1318_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 9.96E-06 9.94E-06 mr1501_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 5.38E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416878791 NA 3.22E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251