\
| Variant ID: vg0416878791 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 16878791 |
| Reference Allele: C | Alternative Allele: T,CAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )
CAGGAGGCTTCGGATCGTTCTCACCCTCACCACTTGGTCGCATCCGACCTTGGCAGGTATAAAGCTAGTTATCCTCTTGCTGCTCGCAGCTAGTTACCCT[C/T,CAA]
TTGTTTTCGGTTTACACCGGCGCTCTTTTGTCTTGAACCTACTGCCGTGAAGATCGGGCCACCCCTCGTGAGTGTATTCGCATCACGTTTGAAGTCAGCC
GGCTGACTTCAAACGTGATGCGAATACACTCACGAGGGGTGGCCCGATCTTCACGGCAGTAGGTTCAAGACAAAAGAGCGCCGGTGTAAACCGAAAACAA[G/A,TTG]
AGGGTAACTAGCTGCGAGCAGCAAGAGGATAACTAGCTTTATACCTGCCAAGGTCGGATGCGACCAAGTGGTGAGGGTGAGAACGATCCGAAGCCTCCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 5.40% | 4.85% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 2.20% | 3.52% | 0.00% | NA |
| All Japonica | 1512 | 79.20% | 12.60% | 8.13% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 84.20% | 5.70% | 10.08% | 0.00% | NA |
| Indica II | 465 | 97.00% | 0.00% | 3.01% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 2.50% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 70.70% | 17.10% | 12.26% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 3.40% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 17.80% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416878791 | C -> CAA | LOC_Os04g28520.1 | upstream_gene_variant ; 3860.0bp to feature; MODIFIER | N | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> CAA | LOC_Os04g28520.2 | upstream_gene_variant ; 3860.0bp to feature; MODIFIER | N | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> CAA | LOC_Os04g28490.1 | downstream_gene_variant ; 2023.0bp to feature; MODIFIER | N | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> CAA | LOC_Os04g28500.1 | downstream_gene_variant ; 786.0bp to feature; MODIFIER | N | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> CAA | LOC_Os04g28500-LOC_Os04g28520 | intergenic_region ; MODIFIER | N | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> T | LOC_Os04g28520.1 | upstream_gene_variant ; 3861.0bp to feature; MODIFIER | silent_mutation | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> T | LOC_Os04g28520.2 | upstream_gene_variant ; 3861.0bp to feature; MODIFIER | silent_mutation | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> T | LOC_Os04g28490.1 | downstream_gene_variant ; 2022.0bp to feature; MODIFIER | silent_mutation | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> T | LOC_Os04g28500.1 | downstream_gene_variant ; 785.0bp to feature; MODIFIER | silent_mutation | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0416878791 | C -> T | LOC_Os04g28500-LOC_Os04g28520 | intergenic_region ; MODIFIER | silent_mutation | Average:62.769; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416878791 | NA | 9.05E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | 3.87E-08 | 2.27E-12 | mr1070 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 1.23E-07 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 4.70E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 2.57E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 7.72E-07 | mr1838 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 7.49E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 3.84E-11 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 2.17E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 2.04E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 3.36E-07 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | 7.29E-06 | 7.79E-10 | mr1204_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | 4.49E-06 | 4.50E-06 | mr1260_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 2.45E-06 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | 9.96E-06 | 9.94E-06 | mr1501_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 5.38E-06 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416878791 | NA | 3.22E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |