Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416838478:

Variant ID: vg0416838478 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 16838478
Reference Allele: TA	Alternative Allele: AA,TAA,T,CA
Primary Allele: AA	Secondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTTCTTTCGGATTGGTTAAGCCTATTGTAAATTTATTCTTTTGATCTTTATATAAATTCATTTACTGTGGGGGATTCCCCTACAATGTTTTCTTTTT[TA/AA,TAA,T,CA]
AAAAAAAAATCTATGTGTCATCCCGTTGATGCGAAAAACATACACTGGCCTGGGAGATCTGCTTAGCTACAGTGCATGTCCAAAGGTTGATGAGATACGG

Reverse complement sequence

CCGTATCTCATCAACCTTTGGACATGCACTGTAGCTAAGCAGATCTCCCAGGCCAGTGTATGTTTTTCGCATCAACGGGATGACACATAGATTTTTTTTT[TA/TT,TTA,A,TG]
AAAAAGAAAACATTGTAGGGGAATCCCCCACAGTAAATGAATTTATATAAAGATCAAAAGAATAAATTTACAATAGGCTTAACCAATCCGAAAGAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of AA(primary allele)	Frequency of TA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.40%	22.80%	16.34%	3.09%	CA: 0.66%; T: 0.44%; TAA: 0.32%
All Indica	2759	67.80%	15.20%	15.44%	1.20%	TAA: 0.33%; CA: 0.07%
All Japonica	1512	41.90%	37.40%	18.92%	0.00%	T: 1.32%; TAA: 0.40%; CA: 0.07%
Aus	269	29.70%	6.70%	13.75%	40.52%	CA: 9.29%
Indica I	595	53.10%	13.60%	32.94%	0.00%	TAA: 0.34%
Indica II	465	76.10%	10.10%	13.33%	0.43%	NA
Indica III	913	78.20%	16.40%	3.72%	1.31%	TAA: 0.22%; CA: 0.11%
Indica Intermediate	786	62.00%	17.80%	17.05%	2.42%	TAA: 0.64%; CA: 0.13%
Temperate Japonica	767	43.70%	29.20%	26.47%	0.00%	TAA: 0.52%; CA: 0.13%
Tropical Japonica	504	32.10%	55.60%	8.33%	0.00%	T: 3.97%
Japonica Intermediate	241	56.40%	25.70%	17.01%	0.00%	TAA: 0.83%
VI/Aromatic	96	33.30%	54.20%	8.33%	4.17%	NA
Intermediate	90	53.30%	25.60%	16.67%	0.00%	CA: 3.33%; T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416838478	TA -> CA	LOC_Os04g28450.1	upstream_gene_variant ; 2438.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> CA	LOC_Os04g28440.1	downstream_gene_variant ; 4293.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> CA	LOC_Os04g28460.1	downstream_gene_variant ; 4805.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> CA	LOC_Os04g28450-LOC_Os04g28460	intergenic_region ; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> DEL	N	N	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> AA	LOC_Os04g28450.1	upstream_gene_variant ; 2438.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> AA	LOC_Os04g28440.1	downstream_gene_variant ; 4293.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> AA	LOC_Os04g28460.1	downstream_gene_variant ; 4805.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> AA	LOC_Os04g28450-LOC_Os04g28460	intergenic_region ; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> TAA	LOC_Os04g28450.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> TAA	LOC_Os04g28440.1	downstream_gene_variant ; 4295.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> TAA	LOC_Os04g28460.1	downstream_gene_variant ; 4803.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> TAA	LOC_Os04g28450-LOC_Os04g28460	intergenic_region ; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> T	LOC_Os04g28450.1	upstream_gene_variant ; 2439.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> T	LOC_Os04g28440.1	downstream_gene_variant ; 4294.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> T	LOC_Os04g28460.1	downstream_gene_variant ; 4804.0bp to feature; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N
vg0416838478	TA -> T	LOC_Os04g28450-LOC_Os04g28460	intergenic_region ; MODIFIER	silent_mutation	Average:35.26; most accessible tissue: Callus, score: 59.766	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416838478	4.96E-06	NA	mr1243_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251