\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416838478:

Variant ID: vg0416838478 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 16838478
Reference Allele: TAAlternative Allele: AA,TAA,T,CA
Primary Allele: AASecondary Allele: TA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTTCTTTCGGATTGGTTAAGCCTATTGTAAATTTATTCTTTTGATCTTTATATAAATTCATTTACTGTGGGGGATTCCCCTACAATGTTTTCTTTTT[TA/AA,TAA,T,CA]
AAAAAAAAATCTATGTGTCATCCCGTTGATGCGAAAAACATACACTGGCCTGGGAGATCTGCTTAGCTACAGTGCATGTCCAAAGGTTGATGAGATACGG

Reverse complement sequence

CCGTATCTCATCAACCTTTGGACATGCACTGTAGCTAAGCAGATCTCCCAGGCCAGTGTATGTTTTTCGCATCAACGGGATGACACATAGATTTTTTTTT[TA/TT,TTA,A,TG]
AAAAAGAAAACATTGTAGGGGAATCCCCCACAGTAAATGAATTTATATAAAGATCAAAAGAATAAATTTACAATAGGCTTAACCAATCCGAAAGAAAATT

Allele Frequencies:

Populations Population SizeFrequency of AA(primary allele) Frequency of TA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 22.80% 16.34% 3.09% CA: 0.66%; T: 0.44%; TAA: 0.32%
All Indica  2759 67.80% 15.20% 15.44% 1.20% TAA: 0.33%; CA: 0.07%
All Japonica  1512 41.90% 37.40% 18.92% 0.00% T: 1.32%; TAA: 0.40%; CA: 0.07%
Aus  269 29.70% 6.70% 13.75% 40.52% CA: 9.29%
Indica I  595 53.10% 13.60% 32.94% 0.00% TAA: 0.34%
Indica II  465 76.10% 10.10% 13.33% 0.43% NA
Indica III  913 78.20% 16.40% 3.72% 1.31% TAA: 0.22%; CA: 0.11%
Indica Intermediate  786 62.00% 17.80% 17.05% 2.42% TAA: 0.64%; CA: 0.13%
Temperate Japonica  767 43.70% 29.20% 26.47% 0.00% TAA: 0.52%; CA: 0.13%
Tropical Japonica  504 32.10% 55.60% 8.33% 0.00% T: 3.97%
Japonica Intermediate  241 56.40% 25.70% 17.01% 0.00% TAA: 0.83%
VI/Aromatic  96 33.30% 54.20% 8.33% 4.17% NA
Intermediate  90 53.30% 25.60% 16.67% 0.00% CA: 3.33%; T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416838478 TA -> CA LOC_Os04g28450.1 upstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> CA LOC_Os04g28440.1 downstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> CA LOC_Os04g28460.1 downstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> CA LOC_Os04g28450-LOC_Os04g28460 intergenic_region ; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> DEL N N silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> AA LOC_Os04g28450.1 upstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> AA LOC_Os04g28440.1 downstream_gene_variant ; 4293.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> AA LOC_Os04g28460.1 downstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> AA LOC_Os04g28450-LOC_Os04g28460 intergenic_region ; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> TAA LOC_Os04g28450.1 upstream_gene_variant ; 2440.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> TAA LOC_Os04g28440.1 downstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> TAA LOC_Os04g28460.1 downstream_gene_variant ; 4803.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> TAA LOC_Os04g28450-LOC_Os04g28460 intergenic_region ; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> T LOC_Os04g28450.1 upstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> T LOC_Os04g28440.1 downstream_gene_variant ; 4294.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> T LOC_Os04g28460.1 downstream_gene_variant ; 4804.0bp to feature; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N
vg0416838478 TA -> T LOC_Os04g28450-LOC_Os04g28460 intergenic_region ; MODIFIER silent_mutation Average:35.26; most accessible tissue: Callus, score: 59.766 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416838478 4.96E-06 NA mr1243_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251