Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416770811:

Variant ID: vg0416770811 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16770811
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCACGTGGTGGTTTAGGAGCGTTTGTAGAGTGCCACATGGCGATATAGGAGCGTTTGTAGGAAGTTTAATGGACTTTTAGTATATAACTAGGAAGGTA[G/A]
TCCGCGCAAATGCGCTGGCACCTTATTTAATGGTGTTTGAAATTTTGTGATGAATGTTTATGTATAGGATTTTTTTTCAAAAAAAATATTTTTATACTCT

Reverse complement sequence

AGAGTATAAAAATATTTTTTTTGAAAAAAAATCCTATACATAAACATTCATCACAAAATTTCAAACACCATTAAATAAGGTGCCAGCGCATTTGCGCGGA[C/T]
TACCTTCCTAGTTATATACTAAAAGTCCATTAAACTTCCTACAAACGCTCCTATATCGCCATGTGGCACTCTACAAACGCTCCTAAACCACCACGTGGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	3.00%	2.62%	1.46%	NA
All Indica	2759	92.90%	3.90%	1.09%	2.10%	NA
All Japonica	1512	97.70%	2.00%	0.26%	0.07%	NA
Aus	269	63.60%	0.00%	33.09%	3.35%	NA
Indica I	595	82.20%	15.00%	2.86%	0.00%	NA
Indica II	465	91.80%	0.40%	0.43%	7.31%	NA
Indica III	913	99.30%	0.00%	0.11%	0.55%	NA
Indica Intermediate	786	94.10%	2.20%	1.27%	2.42%	NA
Temperate Japonica	767	95.60%	3.90%	0.52%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	2.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416770811	G -> DEL	N	N	silent_mutation	Average:40.465; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0416770811	G -> A	LOC_Os04g28350.1	upstream_gene_variant ; 3395.0bp to feature; MODIFIER	silent_mutation	Average:40.465; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0416770811	G -> A	LOC_Os04g28330.1	downstream_gene_variant ; 3145.0bp to feature; MODIFIER	silent_mutation	Average:40.465; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0416770811	G -> A	LOC_Os04g28330-LOC_Os04g28350	intergenic_region ; MODIFIER	silent_mutation	Average:40.465; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416770811	NA	1.53E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	8.25E-06	mr1453	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	4.70E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	4.85E-06	mr1030_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	7.77E-06	7.76E-06	mr1081_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	4.25E-06	NA	mr1342_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	6.19E-06	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	6.86E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	8.07E-06	NA	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	5.09E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	1.14E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416770811	NA	5.13E-06	mr1874_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251