\
| Variant ID: vg0416747657 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16747657 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 128. )
CTACGTATATTGATATGTAGATAATTTTTTTAAGAAACAAAATACAAACGCGCATACACTTTATACACGGGTGACTCACCGTCGACCGCACCCGTATTAA[G/A]
TCTAGAACTTAAACCCTTATACCACGGACGTCTCGCCGTTGAATACGAGCACCTATATTAAGTCTAGAACTTGAACCTGATGAGCCGGTTCTGTCACACG
CGTGTGACAGAACCGGCTCATCAGGTTCAAGTTCTAGACTTAATATAGGTGCTCGTATTCAACGGCGAGACGTCCGTGGTATAAGGGTTTAAGTTCTAGA[C/T]
TTAATACGGGTGCGGTCGACGGTGAGTCACCCGTGTATAAAGTGTATGCGCGTTTGTATTTTGTTTCTTAAAAAAATTATCTACATATCAATATACGTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.10% | 1.50% | 0.00% | NA |
| All Indica | 2759 | 94.40% | 4.30% | 1.30% | 0.00% | NA |
| All Japonica | 1512 | 96.10% | 1.70% | 2.25% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.30% | 15.10% | 5.55% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 3.30% | 4.17% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416747657 | G -> A | LOC_Os04g28290-LOC_Os04g28300 | intergenic_region ; MODIFIER | silent_mutation | Average:50.68; most accessible tissue: Minghui63 root, score: 79.74 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416747657 | 1.44E-06 | 5.63E-06 | mr1329_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 6.84E-07 | 1.12E-06 | mr1337_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 3.36E-06 | NA | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 8.45E-06 | 8.45E-06 | mr1369_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 7.22E-06 | 7.22E-06 | mr1453_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 5.69E-07 | 1.64E-06 | mr1524_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | 8.04E-06 | 8.05E-06 | mr1652_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416747657 | NA | 2.83E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |