\
| Variant ID: vg0416712669 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 16712669 |
| Reference Allele: C | Alternative Allele: A,CA,CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA,CAA |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTACCCCTGCATATTTTTCTCCATGAATCATTAATTCAACCCAAATGGCCATGAATTGTTTTCCGATCTATCTACCCTTATTCCTTGCACCCCTTCTA[C/A,CA,CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA,CAA]
AAAAAAAAGTCGAACTGTATAAATCTAGATATAGACATACTTTCTCCATCCTAAAAAGACGAATCTAAAACTGAATGTGACACATTCTAGTATAATGAAT
ATTCATTATACTAGAATGTGTCACATTCAGTTTTAGATTCGTCTTTTTAGGATGGAGAAAGTATGTCTATATCTAGATTTATACAGTTCGACTTTTTTTT[G/T,TG,TAGAAGGGGTGCAAGGAATAAGGATTTATATAGTTCG,TTG]
TAGAAGGGGTGCAAGGAATAAGGGTAGATAGATCGGAAAACAATTCATGGCCATTTGGGTTGAATTAATGATTCATGGAGAAAAATATGCAGGGGTAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.50% | 0.44% | 0.00% | CA: 0.40%; CAA: 0.08%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.02% |
| All Indica | 2759 | 99.20% | 0.30% | 0.25% | 0.00% | CAA: 0.14%; CA: 0.07%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.04% |
| All Japonica | 1512 | 95.60% | 2.70% | 0.73% | 0.00% | CA: 0.99% |
| Aus | 269 | 91.80% | 7.40% | 0.37% | 0.00% | CA: 0.37% |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.00% | CAA: 0.22% |
| Indica III | 913 | 99.60% | 0.10% | 0.00% | 0.00% | CAA: 0.33% |
| Indica Intermediate | 786 | 98.30% | 1.00% | 0.25% | 0.00% | CA: 0.25%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.13% |
| Temperate Japonica | 767 | 93.40% | 5.10% | 1.30% | 0.00% | CA: 0.26% |
| Tropical Japonica | 504 | 98.40% | 0.20% | 0.20% | 0.00% | CA: 1.19% |
| Japonica Intermediate | 241 | 96.70% | 0.40% | 0.00% | 0.00% | CA: 2.90% |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 0.00% | CA: 1.04% |
| Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416712669 | C -> CA | LOC_Os04g28270.1 | downstream_gene_variant ; 954.0bp to feature; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> CA | LOC_Os04g28260-LOC_Os04g28270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> CAA | LOC_Os04g28270.1 | downstream_gene_variant ; 954.0bp to feature; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> CAA | LOC_Os04g28260-LOC_Os04g28270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> A | LOC_Os04g28270.1 | downstream_gene_variant ; 955.0bp to feature; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> A | LOC_Os04g28260-LOC_Os04g28270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> CGAACTATATAAATCCTTATTCCTTGCACC CCTTCTA | LOC_Os04g28270.1 | downstream_gene_variant ; 954.0bp to feature; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| vg0416712669 | C -> CGAACTATATAAATCCTTATTCCTTGCACC CCTTCTA | LOC_Os04g28260-LOC_Os04g28270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416712669 | 1.69E-08 | 6.86E-11 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 4.79E-06 | 3.66E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 4.36E-08 | 3.86E-12 | mr1585 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 6.92E-09 | 2.76E-11 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 3.49E-06 | 1.78E-08 | mr1765 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 5.75E-07 | 3.68E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416712669 | 1.07E-08 | 1.10E-12 | mr1585_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |