\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416712669:

Variant ID: vg0416712669 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 16712669
Reference Allele: CAlternative Allele: A,CA,CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA,CAA
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTACCCCTGCATATTTTTCTCCATGAATCATTAATTCAACCCAAATGGCCATGAATTGTTTTCCGATCTATCTACCCTTATTCCTTGCACCCCTTCTA[C/A,CA,CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA,CAA]
AAAAAAAAGTCGAACTGTATAAATCTAGATATAGACATACTTTCTCCATCCTAAAAAGACGAATCTAAAACTGAATGTGACACATTCTAGTATAATGAAT

Reverse complement sequence

ATTCATTATACTAGAATGTGTCACATTCAGTTTTAGATTCGTCTTTTTAGGATGGAGAAAGTATGTCTATATCTAGATTTATACAGTTCGACTTTTTTTT[G/T,TG,TAGAAGGGGTGCAAGGAATAAGGATTTATATAGTTCG,TTG]
TAGAAGGGGTGCAAGGAATAAGGGTAGATAGATCGGAAAACAATTCATGGCCATTTGGGTTGAATTAATGATTCATGGAGAAAAATATGCAGGGGTAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.50% 0.44% 0.00% CA: 0.40%; CAA: 0.08%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.02%
All Indica  2759 99.20% 0.30% 0.25% 0.00% CAA: 0.14%; CA: 0.07%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.04%
All Japonica  1512 95.60% 2.70% 0.73% 0.00% CA: 0.99%
Aus  269 91.80% 7.40% 0.37% 0.00% CA: 0.37%
Indica I  595 99.20% 0.00% 0.84% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.00% CAA: 0.22%
Indica III  913 99.60% 0.10% 0.00% 0.00% CAA: 0.33%
Indica Intermediate  786 98.30% 1.00% 0.25% 0.00% CA: 0.25%; CGAACTATATAAATCCTTATTCCTTGCACCCCTTCTA: 0.13%
Temperate Japonica  767 93.40% 5.10% 1.30% 0.00% CA: 0.26%
Tropical Japonica  504 98.40% 0.20% 0.20% 0.00% CA: 1.19%
Japonica Intermediate  241 96.70% 0.40% 0.00% 0.00% CA: 2.90%
VI/Aromatic  96 99.00% 0.00% 0.00% 0.00% CA: 1.04%
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416712669 C -> CA LOC_Os04g28270.1 downstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> CA LOC_Os04g28260-LOC_Os04g28270 intergenic_region ; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> CAA LOC_Os04g28270.1 downstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> CAA LOC_Os04g28260-LOC_Os04g28270 intergenic_region ; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> A LOC_Os04g28270.1 downstream_gene_variant ; 955.0bp to feature; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> A LOC_Os04g28260-LOC_Os04g28270 intergenic_region ; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> CGAACTATATAAATCCTTATTCCTTGCACC CCTTCTA LOC_Os04g28270.1 downstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N
vg0416712669 C -> CGAACTATATAAATCCTTATTCCTTGCACC CCTTCTA LOC_Os04g28260-LOC_Os04g28270 intergenic_region ; MODIFIER silent_mutation Average:50.826; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416712669 1.69E-08 6.86E-11 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 4.79E-06 3.66E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 4.36E-08 3.86E-12 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 6.92E-09 2.76E-11 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 3.49E-06 1.78E-08 mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 5.75E-07 3.68E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416712669 1.07E-08 1.10E-12 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251