\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416574457:

Variant ID: vg0416574457 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16574457
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCGATGTCAAAGACATCGAGCACTCCTTTTCGCTGCCTTTTTTCTCTACTATTATCCACTCATGGTGCCATTTTGCCCATCTTCTTGTAGTTCATGTG[C/T]
AGTTCCGGTGATAAGTTAATCACCAGTTTGTGTTCTCTCACCTCCTCTCTTCCCTTCAGTGCATCGTTCGAGTCGATCTACGTATAACCATTGTCGTCAA

Reverse complement sequence

TTGACGACAATGGTTATACGTAGATCGACTCGAACGATGCACTGAAGGGAAGAGAGGAGGTGAGAGAACACAAACTGGTGATTAACTTATCACCGGAACT[G/A]
CACATGAACTACAAGAAGATGGGCAAAATGGCACCATGAGTGGATAATAGTAGAGAAAAAAGGCAGCGAAAAGGAGTGCTCGATGTCTTTGACATCGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.20% 5.10% 2.67% 0.00% NA
All Indica  2759 88.70% 8.40% 2.86% 0.00% NA
All Japonica  1512 96.80% 0.20% 2.98% 0.00% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 87.60% 4.70% 7.73% 0.00% NA
Indica II  465 95.90% 3.00% 1.08% 0.00% NA
Indica III  913 85.10% 14.20% 0.66% 0.00% NA
Indica Intermediate  786 89.40% 7.80% 2.80% 0.00% NA
Temperate Japonica  767 94.90% 0.00% 5.08% 0.00% NA
Tropical Japonica  504 98.80% 0.60% 0.60% 0.00% NA
Japonica Intermediate  241 98.80% 0.00% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416574457 C -> T LOC_Os04g28060.1 upstream_gene_variant ; 3410.0bp to feature; MODIFIER silent_mutation Average:44.282; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N
vg0416574457 C -> T LOC_Os04g28074.1 intron_variant ; MODIFIER silent_mutation Average:44.282; most accessible tissue: Zhenshan97 young leaf, score: 69.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416574457 3.33E-06 1.63E-06 mr1019_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 2.73E-09 NA mr1023_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 2.80E-07 NA mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 3.61E-07 NA mr1079_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 3.72E-07 NA mr1132_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 3.32E-07 NA mr1390_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 2.98E-10 2.73E-10 mr1489_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 8.65E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416574457 4.83E-06 4.83E-06 mr1778_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251