\
| Variant ID: vg0416558845 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16558845 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 259. )
GTAGGACGGTTTGGTTTCAGGTGTGGCTGGCTTAGAGTTTGAATCACCACCTCTCAAAGGTCTGTATATTACTGTTGTTTCCAGTGTATCTTGTTTCTGC[C/T]
CAAGAGAGACTATCGGAAACAGCATGCCTCTGGGTAAAAGCATATAATGCTGTATGAACTTTGCTGGCAGGGAACGAGTCAAGGACTCCTGAGAGCAAGA
TCTTGCTCTCAGGAGTCCTTGACTCGTTCCCTGCCAGCAAAGTTCATACAGCATTATATGCTTTTACCCAGAGGCATGCTGTTTCCGATAGTCTCTCTTG[G/A]
GCAGAAACAAGATACACTGGAAACAACAGTAATATACAGACCTTTGAGAGGTGGTGATTCAAACTCTAAGCCAGCCACACCTGAAACCAAACCGTCCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 46.70% | 0.08% | 0.51% | NA |
| All Indica | 2759 | 64.50% | 35.00% | 0.07% | 0.43% | NA |
| All Japonica | 1512 | 43.30% | 56.10% | 0.13% | 0.46% | NA |
| Aus | 269 | 2.20% | 96.70% | 0.00% | 1.12% | NA |
| Indica I | 595 | 45.70% | 53.30% | 0.17% | 0.84% | NA |
| Indica II | 465 | 74.20% | 25.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 67.30% | 32.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 69.80% | 29.60% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 37.30% | 61.90% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 50.00% | 49.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 48.50% | 51.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416558845 | C -> DEL | N | N | silent_mutation | Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0416558845 | C -> T | LOC_Os04g28050.1 | upstream_gene_variant ; 3116.0bp to feature; MODIFIER | silent_mutation | Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0416558845 | C -> T | LOC_Os04g28050.2 | upstream_gene_variant ; 3116.0bp to feature; MODIFIER | silent_mutation | Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0416558845 | C -> T | LOC_Os04g28050.3 | upstream_gene_variant ; 3116.0bp to feature; MODIFIER | silent_mutation | Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| vg0416558845 | C -> T | LOC_Os04g28040.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416558845 | NA | 5.59E-06 | mr1019_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 3.86E-06 | mr1036_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 5.13E-07 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 3.18E-10 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 3.77E-08 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 2.60E-09 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 9.80E-08 | mr1347_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 7.64E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416558845 | NA | 2.19E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |