\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416558845:

Variant ID: vg0416558845 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16558845
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGGACGGTTTGGTTTCAGGTGTGGCTGGCTTAGAGTTTGAATCACCACCTCTCAAAGGTCTGTATATTACTGTTGTTTCCAGTGTATCTTGTTTCTGC[C/T]
CAAGAGAGACTATCGGAAACAGCATGCCTCTGGGTAAAAGCATATAATGCTGTATGAACTTTGCTGGCAGGGAACGAGTCAAGGACTCCTGAGAGCAAGA

Reverse complement sequence

TCTTGCTCTCAGGAGTCCTTGACTCGTTCCCTGCCAGCAAAGTTCATACAGCATTATATGCTTTTACCCAGAGGCATGCTGTTTCCGATAGTCTCTCTTG[G/A]
GCAGAAACAAGATACACTGGAAACAACAGTAATATACAGACCTTTGAGAGGTGGTGATTCAAACTCTAAGCCAGCCACACCTGAAACCAAACCGTCCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 46.70% 0.08% 0.51% NA
All Indica  2759 64.50% 35.00% 0.07% 0.43% NA
All Japonica  1512 43.30% 56.10% 0.13% 0.46% NA
Aus  269 2.20% 96.70% 0.00% 1.12% NA
Indica I  595 45.70% 53.30% 0.17% 0.84% NA
Indica II  465 74.20% 25.20% 0.00% 0.65% NA
Indica III  913 67.30% 32.60% 0.00% 0.11% NA
Indica Intermediate  786 69.80% 29.60% 0.13% 0.38% NA
Temperate Japonica  767 37.30% 61.90% 0.13% 0.65% NA
Tropical Japonica  504 50.00% 49.60% 0.00% 0.40% NA
Japonica Intermediate  241 48.50% 51.00% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 0.00% 1.04% NA
Intermediate  90 53.30% 45.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416558845 C -> DEL N N silent_mutation Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0416558845 C -> T LOC_Os04g28050.1 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0416558845 C -> T LOC_Os04g28050.2 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0416558845 C -> T LOC_Os04g28050.3 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0416558845 C -> T LOC_Os04g28040.1 intron_variant ; MODIFIER silent_mutation Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416558845 NA 5.59E-06 mr1019_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 3.86E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 5.13E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 3.18E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 3.77E-08 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 2.60E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 9.80E-08 mr1347_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 7.64E-06 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845 NA 2.19E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251