Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416558845:

Variant ID: vg0416558845 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16558845
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GTAGGACGGTTTGGTTTCAGGTGTGGCTGGCTTAGAGTTTGAATCACCACCTCTCAAAGGTCTGTATATTACTGTTGTTTCCAGTGTATCTTGTTTCTGC[C/T]
CAAGAGAGACTATCGGAAACAGCATGCCTCTGGGTAAAAGCATATAATGCTGTATGAACTTTGCTGGCAGGGAACGAGTCAAGGACTCCTGAGAGCAAGA

Reverse complement sequence

TCTTGCTCTCAGGAGTCCTTGACTCGTTCCCTGCCAGCAAAGTTCATACAGCATTATATGCTTTTACCCAGAGGCATGCTGTTTCCGATAGTCTCTCTTG[G/A]
GCAGAAACAAGATACACTGGAAACAACAGTAATATACAGACCTTTGAGAGGTGGTGATTCAAACTCTAAGCCAGCCACACCTGAAACCAAACCGTCCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	46.70%	0.08%	0.51%	NA
All Indica	2759	64.50%	35.00%	0.07%	0.43%	NA
All Japonica	1512	43.30%	56.10%	0.13%	0.46%	NA
Aus	269	2.20%	96.70%	0.00%	1.12%	NA
Indica I	595	45.70%	53.30%	0.17%	0.84%	NA
Indica II	465	74.20%	25.20%	0.00%	0.65%	NA
Indica III	913	67.30%	32.60%	0.00%	0.11%	NA
Indica Intermediate	786	69.80%	29.60%	0.13%	0.38%	NA
Temperate Japonica	767	37.30%	61.90%	0.13%	0.65%	NA
Tropical Japonica	504	50.00%	49.60%	0.00%	0.40%	NA
Japonica Intermediate	241	48.50%	51.00%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	95.80%	0.00%	1.04%	NA
Intermediate	90	53.30%	45.60%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416558845	C -> DEL	N	N	silent_mutation	Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0416558845	C -> T	LOC_Os04g28050.1	upstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0416558845	C -> T	LOC_Os04g28050.2	upstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0416558845	C -> T	LOC_Os04g28050.3	upstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N
vg0416558845	C -> T	LOC_Os04g28040.1	intron_variant ; MODIFIER	silent_mutation	Average:61.966; most accessible tissue: Zhenshan97 young leaf, score: 76.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416558845	NA	5.59E-06	mr1019_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	3.86E-06	mr1036_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	5.13E-07	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	3.18E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	3.77E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	2.60E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	9.80E-08	mr1347_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	7.64E-06	mr1806_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416558845	NA	2.19E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251