\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416544560:

Variant ID: vg0416544560 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16544560
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, G: 0.15, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGCTTGATTTCCCTTTTACCATAGTTATGAATTTACGATTCCTGACTATTGTATCTAATCAATTGGGCTGCAGTCCTTTTATATCATCGTTTGACTG[C/G,A]
ACAGACTGGACCCTTTAAGGTGTGAGGCTTGGTACTCTCTTACAACTGTGCTGAATTAGTGGCAACAACACTATTGTAGTTTTACTGAATATATTTGCTG

Reverse complement sequence

CAGCAAATATATTCAGTAAAACTACAATAGTGTTGTTGCCACTAATTCAGCACAGTTGTAAGAGAGTACCAAGCCTCACACCTTAAAGGGTCCAGTCTGT[G/C,T]
CAGTCAAACGATGATATAAAAGGACTGCAGCCCAATTGATTAGATACAATAGTCAGGAATCGTAAATTCATAACTATGGTAAAAGGGAAATCAAGCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 42.70% 0.30% 0.19% A: 0.02%
All Indica  2759 65.60% 33.90% 0.25% 0.18% A: 0.04%
All Japonica  1512 53.00% 46.50% 0.33% 0.13% NA
Aus  269 4.10% 94.80% 0.37% 0.74% NA
Indica I  595 45.70% 53.60% 0.34% 0.34% NA
Indica II  465 76.30% 23.20% 0.22% 0.22% NA
Indica III  913 69.30% 30.40% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 70.10% 29.30% 0.38% 0.25% NA
Temperate Japonica  767 39.50% 59.80% 0.39% 0.26% NA
Tropical Japonica  504 70.40% 29.40% 0.20% 0.00% NA
Japonica Intermediate  241 59.80% 39.80% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416544560 C -> A LOC_Os04g28020.1 upstream_gene_variant ; 3739.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> A LOC_Os04g28010.1 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> A LOC_Os04g28010.2 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> A LOC_Os04g28010-LOC_Os04g28020 intergenic_region ; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> DEL N N silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> G LOC_Os04g28020.1 upstream_gene_variant ; 3739.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> G LOC_Os04g28010.1 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> G LOC_Os04g28010.2 downstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544560 C -> G LOC_Os04g28010-LOC_Os04g28020 intergenic_region ; MODIFIER silent_mutation Average:53.683; most accessible tissue: Callus, score: 80.204 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416544560 5.40E-06 6.97E-07 mr1019_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560 NA 1.73E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560 NA 2.37E-11 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560 NA 1.52E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560 NA 4.17E-12 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560 NA 4.88E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251