Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416544560:

Variant ID: vg0416544560 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16544560
Reference Allele: C	Alternative Allele: G,A
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, G: 0.15, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GACGGCTTGATTTCCCTTTTACCATAGTTATGAATTTACGATTCCTGACTATTGTATCTAATCAATTGGGCTGCAGTCCTTTTATATCATCGTTTGACTG[C/G,A]
ACAGACTGGACCCTTTAAGGTGTGAGGCTTGGTACTCTCTTACAACTGTGCTGAATTAGTGGCAACAACACTATTGTAGTTTTACTGAATATATTTGCTG

Reverse complement sequence

CAGCAAATATATTCAGTAAAACTACAATAGTGTTGTTGCCACTAATTCAGCACAGTTGTAAGAGAGTACCAAGCCTCACACCTTAAAGGGTCCAGTCTGT[G/C,T]
CAGTCAAACGATGATATAAAAGGACTGCAGCCCAATTGATTAGATACAATAGTCAGGAATCGTAAATTCATAACTATGGTAAAAGGGAAATCAAGCCGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.80%	42.70%	0.30%	0.19%	A: 0.02%
All Indica	2759	65.60%	33.90%	0.25%	0.18%	A: 0.04%
All Japonica	1512	53.00%	46.50%	0.33%	0.13%	NA
Aus	269	4.10%	94.80%	0.37%	0.74%	NA
Indica I	595	45.70%	53.60%	0.34%	0.34%	NA
Indica II	465	76.30%	23.20%	0.22%	0.22%	NA
Indica III	913	69.30%	30.40%	0.11%	0.00%	A: 0.11%
Indica Intermediate	786	70.10%	29.30%	0.38%	0.25%	NA
Temperate Japonica	767	39.50%	59.80%	0.39%	0.26%	NA
Tropical Japonica	504	70.40%	29.40%	0.20%	0.00%	NA
Japonica Intermediate	241	59.80%	39.80%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	95.80%	1.04%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416544560	C -> A	LOC_Os04g28020.1	upstream_gene_variant ; 3739.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> A	LOC_Os04g28010.1	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> A	LOC_Os04g28010.2	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> A	LOC_Os04g28010-LOC_Os04g28020	intergenic_region ; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> DEL	N	N	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> G	LOC_Os04g28020.1	upstream_gene_variant ; 3739.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> G	LOC_Os04g28010.1	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> G	LOC_Os04g28010.2	downstream_gene_variant ; 1877.0bp to feature; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N
vg0416544560	C -> G	LOC_Os04g28010-LOC_Os04g28020	intergenic_region ; MODIFIER	silent_mutation	Average:53.683; most accessible tissue: Callus, score: 80.204	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416544560	5.40E-06	6.97E-07	mr1019_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560	NA	1.73E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560	NA	2.37E-11	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560	NA	1.52E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560	NA	4.17E-12	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544560	NA	4.88E-07	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251