\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416544450:

Variant ID: vg0416544450 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16544450
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TAATCATTTTTTAGCAATATTACAGAATCATTTAATCTATTAATTTCAGTCTCAGGAATATATTTGAAAGCTGCCAGCATTTGCTGTTAGGTTTTAGGCC[A/G]
CAGTTGGATGACGGCTTGATTTCCCTTTTACCATAGTTATGAATTTACGATTCCTGACTATTGTATCTAATCAATTGGGCTGCAGTCCTTTTATATCATC

Reverse complement sequence

GATGATATAAAAGGACTGCAGCCCAATTGATTAGATACAATAGTCAGGAATCGTAAATTCATAACTATGGTAAAAGGGAAATCAAGCCGTCATCCAACTG[T/C]
GGCCTAAAACCTAACAGCAAATGCTGGCAGCTTTCAAATATATTCCTGAGACTGAAATTAATAGATTAAATGATTCTGTAATATTGCTAAAAAATGATTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 35.50% 0.15% 0.51% NA
All Indica  2759 73.10% 26.40% 0.14% 0.43% NA
All Japonica  1512 53.60% 45.80% 0.13% 0.53% NA
Aus  269 48.30% 50.60% 0.37% 0.74% NA
Indica I  595 57.00% 42.20% 0.17% 0.67% NA
Indica II  465 77.00% 22.60% 0.00% 0.43% NA
Indica III  913 79.50% 20.40% 0.00% 0.11% NA
Indica Intermediate  786 75.40% 23.50% 0.38% 0.64% NA
Temperate Japonica  767 39.50% 59.50% 0.26% 0.78% NA
Tropical Japonica  504 71.60% 28.20% 0.00% 0.20% NA
Japonica Intermediate  241 60.60% 39.00% 0.00% 0.41% NA
VI/Aromatic  96 3.10% 94.80% 0.00% 2.08% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416544450 A -> DEL N N silent_mutation Average:51.699; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544450 A -> G LOC_Os04g28020.1 upstream_gene_variant ; 3849.0bp to feature; MODIFIER silent_mutation Average:51.699; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544450 A -> G LOC_Os04g28010.1 downstream_gene_variant ; 1767.0bp to feature; MODIFIER silent_mutation Average:51.699; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544450 A -> G LOC_Os04g28010.2 downstream_gene_variant ; 1767.0bp to feature; MODIFIER silent_mutation Average:51.699; most accessible tissue: Callus, score: 80.204 N N N N
vg0416544450 A -> G LOC_Os04g28010-LOC_Os04g28020 intergenic_region ; MODIFIER silent_mutation Average:51.699; most accessible tissue: Callus, score: 80.204 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416544450 NA 3.95E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416544450 NA 1.33E-06 mr1806_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251