\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0416401038:

Variant ID: vg0416401038 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16401038
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCTACTACACATGTTGAGAGCCATGATAATCTCAGGTCTAAGGATTCAACACCAACACTCAATGAGATCACTGATGACACAACACATATGGCTCTTG[C/T]
AGTGTCTCATGTTGGGTCTATCCAACAACATGTTCACCAACATGTGTCCATATTATTAATTTGGTATCTCTATACCATGATCCATGAGACATGATCATCA

Reverse complement sequence

TGATGATCATGTCTCATGGATCATGGTATAGAGATACCAAATTAATAATATGGACACATGTTGGTGAACATGTTGTTGGATAGACCCAACATGAGACACT[G/A]
CAAGAGCCATATGTGTTGTGTCATCAGTGATCTCATTGAGTGTTGGTGTTGAATCCTTAGACCTGAGATTATCATGGCTCTCAACATGTGTAGTAGCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.60% 0.00% 0.00% NA
All Indica  2759 98.20% 1.80% 0.00% 0.00% NA
All Japonica  1512 91.10% 8.90% 0.00% 0.00% NA
Aus  269 53.50% 46.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 75.00% 25.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416401038 C -> T LOC_Os04g27750.1 upstream_gene_variant ; 1106.0bp to feature; MODIFIER silent_mutation Average:39.959; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0416401038 C -> T LOC_Os04g27740.1 downstream_gene_variant ; 2232.0bp to feature; MODIFIER silent_mutation Average:39.959; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N
vg0416401038 C -> T LOC_Os04g27740-LOC_Os04g27750 intergenic_region ; MODIFIER silent_mutation Average:39.959; most accessible tissue: Zhenshan97 flag leaf, score: 56.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416401038 NA 1.01E-06 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 3.13E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 5.73E-06 6.42E-10 mr1058 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 4.52E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 1.20E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 7.67E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 4.22E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 9.86E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 3.74E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 6.68E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 2.31E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 1.25E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 9.48E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 3.51E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 1.67E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416401038 NA 8.33E-10 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251