Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0416243452:

Variant ID: vg0416243452 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 16243452
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCCTCCCTCGGGTTCGATGGGCCGAATCCCTCTCGGCCCATCTCCCCCTCCCTCCCCGGCTCTCTCTCTCTCTCTCTCTCCCTCTCCCCCGCTCTGCC[C/T,A]
GTGCGCAGCGCACCCGTGCGCGTGAGCCGCGCCGAGCCGAGCGCCCTCCGCCCTCGCTGCTGTTTCCCGCCGAGCGCCAGCTCGCTCCCTTGACCGCCCA

Reverse complement sequence

TGGGCGGTCAAGGGAGCGAGCTGGCGCTCGGCGGGAAACAGCAGCGAGGGCGGAGGGCGCTCGGCTCGGCGCGGCTCACGCGCACGGGTGCGCTGCGCAC[G/A,T]
GGCAGAGCGGGGGAGAGGGAGAGAGAGAGAGAGAGAGAGCCGGGGAGGGAGGGGGAGATGGGCCGAGAGGGATTCGGCCCATCGAACCCGAGGGAGGCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 11.70% 5.84% 26.28% A: 0.02%
All Indica  2759 69.70% 3.70% 6.56% 20.01% A: 0.04%
All Japonica  1512 36.10% 24.10% 4.96% 34.85% NA
Aus  269 46.10% 1.10% 4.09% 48.70% NA
Indica I  595 68.90% 6.20% 13.78% 11.09% NA
Indica II  465 79.60% 6.90% 6.88% 6.67% NA
Indica III  913 61.00% 0.70% 0.88% 37.35% A: 0.11%
Indica Intermediate  786 74.70% 3.30% 7.51% 14.50% NA
Temperate Japonica  767 23.90% 40.90% 5.87% 29.34% NA
Tropical Japonica  504 41.90% 4.80% 2.18% 51.19% NA
Japonica Intermediate  241 63.10% 10.80% 7.88% 18.26% NA
VI/Aromatic  96 12.50% 69.80% 1.04% 16.67% NA
Intermediate  90 51.10% 22.20% 8.89% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0416243452 C -> DEL N N silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> A LOC_Os04g27470.1 upstream_gene_variant ; 2451.0bp to feature; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> A LOC_Os04g27490.1 upstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> A LOC_Os04g27480.1 intron_variant ; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> T LOC_Os04g27470.1 upstream_gene_variant ; 2451.0bp to feature; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> T LOC_Os04g27490.1 upstream_gene_variant ; 2356.0bp to feature; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0416243452 C -> T LOC_Os04g27480.1 intron_variant ; MODIFIER silent_mutation Average:63.959; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0416243452 C A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0416243452 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0416243452 NA 3.37E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416243452 7.18E-07 7.18E-07 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416243452 NA 1.32E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416243452 NA 4.92E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416243452 NA 3.61E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416243452 NA 1.04E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251