\
| Variant ID: vg0416229064 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16229064 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATTACAAATTATAACAACTTCAAACAACATTTTCAAATACTAAATGATTTCAACTGAAAAAGTCATCAACAACAAAGTTGTATAACTCATCAATATCTA[C/T]
AACTTTTTTTGGTCATTTCTTCATCCGATAAAGTTATAATAATATTGTACACAAAATTTATATATATATCTCTTATAGGTTATAAAACCATATAAGAGAT
ATCTCTTATATGGTTTTATAACCTATAAGAGATATATATATAAATTTTGTGTACAATATTATTATAACTTTATCGGATGAAGAAATGACCAAAAAAAGTT[G/A]
TAGATATTGATGAGTTATACAACTTTGTTGTTGATGACTTTTTCAGTTGAAATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTTATAATTTGTAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 1.10% | 21.67% | 0.80% | NA |
| All Indica | 2759 | 83.60% | 0.60% | 15.01% | 0.80% | NA |
| All Japonica | 1512 | 64.40% | 2.10% | 32.61% | 0.86% | NA |
| Aus | 269 | 63.60% | 1.10% | 34.20% | 1.12% | NA |
| Indica I | 595 | 94.10% | 0.20% | 5.21% | 0.50% | NA |
| Indica II | 465 | 93.50% | 0.40% | 5.81% | 0.22% | NA |
| Indica III | 913 | 67.90% | 0.80% | 30.01% | 1.31% | NA |
| Indica Intermediate | 786 | 88.00% | 0.80% | 10.43% | 0.76% | NA |
| Temperate Japonica | 767 | 69.90% | 1.20% | 27.90% | 1.04% | NA |
| Tropical Japonica | 504 | 47.80% | 3.80% | 47.62% | 0.79% | NA |
| Japonica Intermediate | 241 | 81.70% | 1.70% | 16.18% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 2.10% | 13.54% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 1.10% | 13.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416229064 | C -> DEL | N | N | silent_mutation | Average:35.242; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0416229064 | C -> T | LOC_Os04g27450.1 | upstream_gene_variant ; 4654.0bp to feature; MODIFIER | silent_mutation | Average:35.242; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0416229064 | C -> T | LOC_Os04g27440.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:35.242; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| vg0416229064 | C -> T | LOC_Os04g27430-LOC_Os04g27440 | intergenic_region ; MODIFIER | silent_mutation | Average:35.242; most accessible tissue: Zhenshan97 young leaf, score: 50.669 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416229064 | 7.13E-07 | 7.13E-07 | mr1440_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |