Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0416149416:

Variant ID: vg0416149416 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 16149416
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAGCACTGGAGACTAGCCATTTAGGTCTCTTAGGCTTTTGATTGATGCACTTATCCATCATTTAGACAAGTTATTACATGTTACATGTTAAAATTTTCT[T/C]
AGAATTTCTGGGTATGCCGGTGCATACCCGGCACACCTCCTAGGTCCACCCCTCTGATCAGGGCATAGGTTTACAAGTTAGACCCGGGCAATTTGAGTCA

Reverse complement sequence

TGACTCAAATTGCCCGGGTCTAACTTGTAAACCTATGCCCTGATCAGAGGGGTGGACCTAGGAGGTGTGCCGGGTATGCACCGGCATACCCAGAAATTCT[A/G]
AGAAAATTTTAACATGTAACATGTAATAACTTGTCTAAATGATGGATAAGTGCATCAATCAAAAGCCTAAGAGACCTAAATGGCTAGTCTCCAGTGCTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	11.00%	0.95%	8.59%	NA
All Indica	2759	75.30%	11.20%	1.01%	12.43%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	4.10%	69.50%	4.83%	21.56%	NA
Indica I	595	89.10%	6.40%	0.67%	3.87%	NA
Indica II	465	79.40%	14.80%	1.29%	4.52%	NA
Indica III	913	60.20%	13.40%	1.20%	25.19%	NA
Indica Intermediate	786	80.00%	10.30%	0.89%	8.78%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	85.40%	10.40%	4.17%	0.00%	NA
Intermediate	90	87.80%	6.70%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0416149416	T -> C	LOC_Os04g27320.1	downstream_gene_variant ; 1021.0bp to feature; MODIFIER	silent_mutation	Average:63.098; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0416149416	T -> C	LOC_Os04g27330.1	downstream_gene_variant ; 522.0bp to feature; MODIFIER	silent_mutation	Average:63.098; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0416149416	T -> C	LOC_Os04g27340.1	downstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:63.098; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0416149416	T -> C	LOC_Os04g27320-LOC_Os04g27330	intergenic_region ; MODIFIER	silent_mutation	Average:63.098; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0416149416	T -> DEL	N	N	silent_mutation	Average:63.098; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0416149416	NA	3.22E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416149416	6.78E-06	NA	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416149416	NA	8.96E-09	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0416149416	9.13E-07	NA	mr1866_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251