| Variant ID: vg0416033751 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 16033751 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATATATACCGATCATAAGAGTTTGAAATACATCTTCACTCAGTCGGATCTGAATCTTCGGCAGAGAAGATGGTTAGAACTCATCAAGGATTATGATGTG[A/G]
GAATTCACTATCATCCTGGCAAGGCCAACGTGGTCGCCGACCCTCTAAGTCGAAAAAGCCATTGCAACACTCTTGGCGTCCGTGGCATTCCACCGGAACT
AGTTCCGGTGGAATGCCACGGACGCCAAGAGTGTTGCAATGGCTTTTTCGACTTAGAGGGTCGGCGACCACGTTGGCCTTGCCAGGATGATAGTGAATTC[T/C]
CACATCATAATCCTTGATGAGTTCTAACCATCTTCTCTGCCGAAGATTCAGATCCGACTGAGTGAAGATGTATTTCAAACTCTTATGATCGGTATATATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.20% | 3.50% | 12.89% | 3.41% | NA |
| All Indica | 2759 | 77.00% | 5.80% | 11.96% | 5.26% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 9.70% | 0.40% | 89.22% | 0.74% | NA |
| Indica I | 595 | 89.10% | 10.80% | 0.00% | 0.17% | NA |
| Indica II | 465 | 81.30% | 0.90% | 13.98% | 3.87% | NA |
| Indica III | 913 | 62.30% | 7.00% | 20.37% | 10.30% | NA |
| Indica Intermediate | 786 | 82.40% | 3.40% | 10.05% | 4.07% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 1.00% | 29.17% | 12.50% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 10.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0416033751 | A -> DEL | N | N | silent_mutation | Average:53.691; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0416033751 | A -> G | LOC_Os04g27092.1 | upstream_gene_variant ; 1541.0bp to feature; MODIFIER | silent_mutation | Average:53.691; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0416033751 | A -> G | LOC_Os04g27092-LOC_Os04g27094 | intergenic_region ; MODIFIER | silent_mutation | Average:53.691; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0416033751 | 1.49E-06 | 2.80E-08 | mr1043_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416033751 | 1.56E-06 | 6.42E-08 | mr1185_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416033751 | NA | 1.21E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416033751 | NA | 5.50E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416033751 | 7.37E-06 | 3.12E-07 | mr1677_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0416033751 | 9.14E-07 | 4.05E-06 | mr1912_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |