Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415966080:

Variant ID: vg0415966080 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15966080
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAATTGGTGTGTTCTATACGTCATATTTTAAGGGTATCGGTAGATATATTTTAGGTCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCT[G/A,T]
TCACGTTTTTTTAGGGACTAAGGCATTTTTTTGCTTAGGCAAAAGTGCGCGTGATTAAGTGCCCAATACCTTAAAATCCTTTTATACCGCAGTTACTCAA

Reverse complement sequence

TTGAGTAACTGCGGTATAAAAGGATTTTAAGGTATTGGGCACTTAATCACGCGCACTTTTGCCTAAGCAAAAAAATGCCTTAGTCCCTAAAAAAACGTGA[C/T,A]
AGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGACCTAAAATATATCTACCGATACCCTTAAAATATGACGTATAGAACACACCAATTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.20%	2.10%	6.69%	2.96%	T: 0.02%
All Indica	2759	89.50%	1.80%	5.36%	3.33%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	7.80%	17.10%	58.36%	16.36%	T: 0.37%
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	72.00%	6.20%	13.33%	8.39%	NA
Indica III	913	92.30%	1.30%	3.83%	2.52%	NA
Indica Intermediate	786	88.50%	1.10%	6.49%	3.82%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	2.10%	6.25%	2.08%	NA
Intermediate	90	93.30%	0.00%	4.44%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415966080	G -> DEL	N	N	silent_mutation	Average:31.942; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0415966080	G -> A	LOC_Os04g26994.1	upstream_gene_variant ; 2750.0bp to feature; MODIFIER	silent_mutation	Average:31.942; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0415966080	G -> A	LOC_Os04g26980-LOC_Os04g26994	intergenic_region ; MODIFIER	silent_mutation	Average:31.942; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0415966080	G -> T	LOC_Os04g26994.1	upstream_gene_variant ; 2750.0bp to feature; MODIFIER	silent_mutation	Average:31.942; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N
vg0415966080	G -> T	LOC_Os04g26980-LOC_Os04g26994	intergenic_region ; MODIFIER	silent_mutation	Average:31.942; most accessible tissue: Minghui63 flag leaf, score: 59.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415966080	NA	8.94E-06	mr1614	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	2.37E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	3.91E-06	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	2.06E-06	mr1749	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	6.93E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	5.49E-09	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	1.20E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	2.05E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	6.01E-08	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	3.80E-09	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	9.29E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	4.10E-07	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	5.28E-06	mr1363_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	3.30E-07	mr1527_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	4.07E-06	1.17E-06	mr1623_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	4.06E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415966080	NA	4.06E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251