\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415965987:

Variant ID: vg0415965987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15965987
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGGATTCAATTATCACATCTACTTTGGTATTCTTCATGAGGGATAATTACGCGATCTACATCACCCAGGATATTTATCACTTGGGATCATATTAATTG[G/T]
TGTGTTCTATACGTCATATTTTAAGGGTATCGGTAGATATATTTTAGGTCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCTGTCACGTT

Reverse complement sequence

AACGTGACAGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGACCTAAAATATATCTACCGATACCCTTAAAATATGACGTATAGAACACA[C/A]
CAATTAATATGATCCCAAGTGATAAATATCCTGGGTGATGTAGATCGCGTAATTATCCCTCATGAAGAATACCAAAGTAGATGTGATAATTGAATCCCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 12.00% 2.16% 0.28% NA
All Indica  2759 86.60% 10.40% 2.68% 0.33% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 11.50% 80.30% 7.06% 1.12% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 69.50% 24.90% 4.30% 1.29% NA
Indica III  913 90.40% 8.20% 1.31% 0.11% NA
Indica Intermediate  786 82.40% 12.00% 5.34% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 49.00% 46.90% 3.12% 1.04% NA
Intermediate  90 80.00% 15.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415965987 G -> DEL N N silent_mutation Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0415965987 G -> T LOC_Os04g26994.1 upstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N
vg0415965987 G -> T LOC_Os04g26980-LOC_Os04g26994 intergenic_region ; MODIFIER silent_mutation Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415965987 7.69E-06 2.28E-09 mr1322_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 6.78E-07 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 5.04E-06 mr1363_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 2.62E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 1.56E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 1.49E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987 NA 8.39E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251