Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415965987:

Variant ID: vg0415965987 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15965987
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGGATTCAATTATCACATCTACTTTGGTATTCTTCATGAGGGATAATTACGCGATCTACATCACCCAGGATATTTATCACTTGGGATCATATTAATTG[G/T]
TGTGTTCTATACGTCATATTTTAAGGGTATCGGTAGATATATTTTAGGTCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCTGTCACGTT

Reverse complement sequence

AACGTGACAGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGACCTAAAATATATCTACCGATACCCTTAAAATATGACGTATAGAACACA[C/A]
CAATTAATATGATCCCAAGTGATAAATATCCTGGGTGATGTAGATCGCGTAATTATCCCTCATGAAGAATACCAAAGTAGATGTGATAATTGAATCCCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	12.00%	2.16%	0.28%	NA
All Indica	2759	86.60%	10.40%	2.68%	0.33%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	11.50%	80.30%	7.06%	1.12%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	69.50%	24.90%	4.30%	1.29%	NA
Indica III	913	90.40%	8.20%	1.31%	0.11%	NA
Indica Intermediate	786	82.40%	12.00%	5.34%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.41%	0.00%	NA
VI/Aromatic	96	49.00%	46.90%	3.12%	1.04%	NA
Intermediate	90	80.00%	15.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415965987	G -> DEL	N	N	silent_mutation	Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0415965987	G -> T	LOC_Os04g26994.1	upstream_gene_variant ; 2843.0bp to feature; MODIFIER	silent_mutation	Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0415965987	G -> T	LOC_Os04g26980-LOC_Os04g26994	intergenic_region ; MODIFIER	silent_mutation	Average:33.032; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415965987	7.69E-06	2.28E-09	mr1322_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	6.78E-07	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	5.04E-06	mr1363_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	2.62E-07	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	1.56E-06	mr1623_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	1.49E-09	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415965987	NA	8.39E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251