\
| Variant ID: vg0415909654 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15909654 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCCGTGCCTCTTCTTAGATGGTGTCATCCTCATAGGCTGCCATCGCCGCCATGACCATGGTGATCAAGGAGGTTATCTCTTTCTTCGCACCTGCCTCT[G/A]
CTGCCCTCATCCGAGTCGTCAGCCTCGTTGCCACTTTTGTCCTCGTTCTATTCCTTCAGCGATAGTGGGCCCTCGTTGGAGTCCTTTGATAGGACCTGTT
AACAGGTCCTATCAAAGGACTCCAACGAGGGCCCACTATCGCTGAAGGAATAGAACGAGGACAAAAGTGGCAACGAGGCTGACGACTCGGATGAGGGCAG[C/T]
AGAGGCAGGTGCGAAGAAAGAGATAACCTCCTTGATCACCATGGTCATGGCGGCGATGGCAGCCTATGAGGATGACACCATCTAAGAAGAGGCACGGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.30% | 6.10% | 1.67% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.40% | 0.94% | 0.00% | NA |
| All Japonica | 1512 | 79.00% | 17.70% | 3.31% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 0.00% | 2.86% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 63.40% | 32.30% | 4.30% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 0.60% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 6.60% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 8.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415909654 | G -> A | LOC_Os04g26890.1 | downstream_gene_variant ; 4230.0bp to feature; MODIFIER | silent_mutation | Average:64.553; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0415909654 | G -> A | LOC_Os04g26890-LOC_Os04g26910 | intergenic_region ; MODIFIER | silent_mutation | Average:64.553; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415909654 | NA | 1.39E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 5.89E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 7.75E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 3.68E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 6.32E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 1.23E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 8.90E-09 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 2.84E-06 | mr1748_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 6.22E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415909654 | NA | 8.30E-06 | mr1865_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |