\
| Variant ID: vg0415354509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15354509 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAACGAACCATATCCTGTGCCATAAATATATCTTCTGAGAATTAATATACTAAGGATAAAATCTGTCATATAGTATTAATAACCCTCCTCAGAGGACA[A/T]
TTGCATGCCTGCATCTTTTTTTATGTACTTGTTTCTGGGTTTCTTTTATTGCCATGTCCTGTTTGGGTTTCTTTTATTGCCATGTCCTATTTGGGTTTCT
AGAAACCCAAATAGGACATGGCAATAAAAGAAACCCAAACAGGACATGGCAATAAAAGAAACCCAGAAACAAGTACATAAAAAAAGATGCAGGCATGCAA[T/A]
TGTCCTCTGAGGAGGGTTATTAATACTATATGACAGATTTTATCCTTAGTATATTAATTCTCAGAAGATATATTTATGGCACAGGATATGGTTCGTTATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 0.70% | 2.09% | 6.77% | NA |
| All Indica | 2759 | 93.80% | 1.10% | 2.36% | 2.72% | NA |
| All Japonica | 1512 | 82.10% | 0.00% | 1.92% | 15.94% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 1.70% | 4.20% | 6.72% | NA |
| Indica II | 465 | 91.20% | 1.30% | 4.09% | 3.44% | NA |
| Indica III | 913 | 98.90% | 0.00% | 0.11% | 0.99% | NA |
| Indica Intermediate | 786 | 94.30% | 1.90% | 2.54% | 1.27% | NA |
| Temperate Japonica | 767 | 66.60% | 0.00% | 3.39% | 29.99% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 0.83% | 3.73% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 1.10% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415354509 | A -> DEL | N | N | silent_mutation | Average:26.939; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0415354509 | A -> T | LOC_Os04g26330.1 | upstream_gene_variant ; 2445.0bp to feature; MODIFIER | silent_mutation | Average:26.939; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0415354509 | A -> T | LOC_Os04g26340.1 | upstream_gene_variant ; 4429.0bp to feature; MODIFIER | silent_mutation | Average:26.939; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| vg0415354509 | A -> T | LOC_Os04g26330-LOC_Os04g26340 | intergenic_region ; MODIFIER | silent_mutation | Average:26.939; most accessible tissue: Minghui63 flag leaf, score: 45.195 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415354509 | 9.55E-06 | 9.55E-06 | mr1173 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415354509 | 1.72E-06 | 1.72E-06 | mr1381 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415354509 | 3.56E-06 | 3.56E-06 | mr1381 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415354509 | NA | 4.53E-06 | mr1933 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |