\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415328744:

Variant ID: vg0415328744 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15328744
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGTCTCCAGGGAGCCGGTCTGACCGGGCATGTGCCGCCGGTCAGACCGACTTTATGGGACGGTCGGACCGCCAACTTGGGGCCGGTCAGACCGGCCAGG[A/G]
CATTCCGGTCAGACCGCCACTATGTGGCCGGTCTGACCGCCCCTGGTCAGGCCGAATCCAGTGAATGTGTGTGTGTGATGAAAAAGTGAGCACAAGTGAT

Reverse complement sequence

ATCACTTGTGCTCACTTTTTCATCACACACACACATTCACTGGATTCGGCCTGACCAGGGGCGGTCAGACCGGCCACATAGTGGCGGTCTGACCGGAATG[T/C]
CCTGGCCGGTCTGACCGGCCCCAAGTTGGCGGTCCGACCGTCCCATAAAGTCGGTCTGACCGGCGGCACATGCCCGGTCAGACCGGCTCCCTGGAGACCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.80% 10.20% 4.44% 14.47% NA
All Indica  2759 72.70% 8.00% 2.50% 16.82% NA
All Japonica  1512 78.00% 2.00% 8.80% 11.24% NA
Aus  269 2.20% 84.80% 1.86% 11.15% NA
Indica I  595 89.60% 0.30% 1.34% 8.74% NA
Indica II  465 64.30% 21.30% 2.80% 11.61% NA
Indica III  913 62.00% 6.10% 3.40% 28.48% NA
Indica Intermediate  786 77.20% 8.10% 2.16% 12.47% NA
Temperate Japonica  767 59.60% 3.70% 16.69% 20.08% NA
Tropical Japonica  504 98.80% 0.00% 0.40% 0.79% NA
Japonica Intermediate  241 92.90% 0.80% 1.24% 4.98% NA
VI/Aromatic  96 91.70% 1.00% 1.04% 6.25% NA
Intermediate  90 77.80% 4.40% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415328744 A -> DEL N N silent_mutation Average:64.45; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg0415328744 A -> G LOC_Os04g26290.1 upstream_gene_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:64.45; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg0415328744 A -> G LOC_Os04g26300.1 upstream_gene_variant ; 3715.0bp to feature; MODIFIER silent_mutation Average:64.45; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg0415328744 A -> G LOC_Os04g26290-LOC_Os04g26300 intergenic_region ; MODIFIER silent_mutation Average:64.45; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0415328744 A G 0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415328744 NA 7.54E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 7.96E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 8.82E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 9.93E-09 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 3.84E-07 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 4.55E-08 mr1326_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 5.90E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 5.17E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415328744 NA 8.60E-06 mr1686_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251