\
| Variant ID: vg0415230434 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15230434 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATTCACGTGCTCACTGATTCTTGTACTCCCTCCGTATCACAATTAGAAGATGTTTTGCGTGGCCGTCGTACTTTCACGTTTAGATGATGTTCCTAGCC[A/G]
CACGTACAAAAGCCGACGAAATTGCCCCTGCCTCCTCGATCTCAACCCCACGCCGGCGCTGTATTAACTTCGCACTCTTCGGTTCCACCACGCGCTTTTC
GAAAAGCGCGTGGTGGAACCGAAGAGTGCGAAGTTAATACAGCGCCGGCGTGGGGTTGAGATCGAGGAGGCAGGGGCAATTTCGTCGGCTTTTGTACGTG[T/C]
GGCTAGGAACATCATCTAAACGTGAAAGTACGACGGCCACGCAAAACATCTTCTAATTGTGATACGGAGGGAGTACAAGAATCAGTGAGCACGTGAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 14.20% | 9.63% | 6.52% | NA |
| All Indica | 2759 | 66.90% | 14.30% | 10.80% | 7.97% | NA |
| All Japonica | 1512 | 85.60% | 0.30% | 9.39% | 4.76% | NA |
| Aus | 269 | 4.10% | 95.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.40% | 0.80% | 30.92% | 0.84% | NA |
| Indica II | 465 | 67.30% | 26.70% | 3.66% | 2.37% | NA |
| Indica III | 913 | 59.90% | 17.10% | 5.26% | 17.74% | NA |
| Indica Intermediate | 786 | 74.60% | 13.90% | 6.23% | 5.34% | NA |
| Temperate Japonica | 767 | 78.20% | 0.10% | 15.51% | 6.13% | NA |
| Tropical Japonica | 504 | 94.00% | 0.40% | 1.98% | 3.57% | NA |
| Japonica Intermediate | 241 | 91.30% | 0.40% | 5.39% | 2.90% | NA |
| VI/Aromatic | 96 | 74.00% | 7.30% | 9.38% | 9.38% | NA |
| Intermediate | 90 | 75.60% | 11.10% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415230434 | A -> DEL | N | N | silent_mutation | Average:43.623; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0415230434 | A -> G | LOC_Os04g26130.1 | downstream_gene_variant ; 64.0bp to feature; MODIFIER | silent_mutation | Average:43.623; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0415230434 | A -> G | LOC_Os04g26120-LOC_Os04g26130 | intergenic_region ; MODIFIER | silent_mutation | Average:43.623; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415230434 | NA | 6.91E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415230434 | NA | 5.87E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415230434 | NA | 6.94E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415230434 | 6.38E-08 | 6.38E-08 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |