Variant ID: vg0415210679 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 15210679 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTCTGCAAAAGATCCAAGCCTCTGTAGTGTCGGGGACCTCGCAGCCATTCACACTATATTTAAAAAGGGATTAGAATTTTAAAGATATAAGTAACAAGA[C/T]
AACCAGTGCATACCAGTTAAAATGACAAAATGAGACCACACATAGCTCTAGATCACACATCTCCATATCTCCAGTTACTAAATGGAAGTGTCTTATAGAA
TTCTATAAGACACTTCCATTTAGTAACTGGAGATATGGAGATGTGTGATCTAGAGCTATGTGTGGTCTCATTTTGTCATTTTAACTGGTATGCACTGGTT[G/A]
TCTTGTTACTTATATCTTTAAAATTCTAATCCCTTTTTAAATATAGTGTGAATGGCTGCGAGGTCCCCGACACTACAGAGGCTTGGATCTTTTGCAGAAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 68.30% | 16.80% | 4.72% | 10.18% | NA |
All Indica | 2759 | 65.20% | 18.10% | 6.81% | 9.93% | NA |
All Japonica | 1512 | 85.20% | 0.50% | 0.99% | 13.29% | NA |
Aus | 269 | 2.60% | 97.00% | 0.00% | 0.37% | NA |
Indica I | 595 | 65.70% | 10.40% | 1.18% | 22.69% | NA |
Indica II | 465 | 64.50% | 30.50% | 1.51% | 3.44% | NA |
Indica III | 913 | 58.50% | 18.60% | 15.33% | 7.56% | NA |
Indica Intermediate | 786 | 72.90% | 15.90% | 4.33% | 6.87% | NA |
Temperate Japonica | 767 | 77.70% | 0.40% | 1.04% | 20.86% | NA |
Tropical Japonica | 504 | 93.70% | 0.20% | 0.60% | 5.56% | NA |
Japonica Intermediate | 241 | 91.30% | 1.70% | 1.66% | 5.39% | NA |
VI/Aromatic | 96 | 71.90% | 14.60% | 12.50% | 1.04% | NA |
Intermediate | 90 | 72.20% | 14.40% | 8.89% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0415210679 | C -> DEL | N | N | silent_mutation | Average:12.12; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
vg0415210679 | C -> T | LOC_Os04g26120.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.12; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0415210679 | 2.07E-06 | 1.26E-06 | mr1094 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 1.16E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 6.24E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 4.10E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 3.62E-06 | mr1637 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 9.80E-06 | mr1669 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 2.52E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 5.34E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0415210679 | NA | 6.88E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |