\
| Variant ID: vg0415203314 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15203314 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CGAAGTCACCATTGATTCTATGGCGAACATGGATGTCAGCGGTGGCATGACCATTGAGGGTCTCTGTTCAGTGGAGATGAAAGAAGCAAGTTGGCCTTGA[T/C]
GATGTAGCAGTGGACTCAGACATGTCGAGTTGAACACTGCCGATGCTATATATGCATCCTAGAGGCTTGTTGCAAGCGACATTGTGATGTCCGTGGGCTA
TAGCCCACGGACATCACAATGTCGCTTGCAACAAGCCTCTAGGATGCATATATAGCATCGGCAGTGTTCAACTCGACATGTCTGAGTCCACTGCTACATC[A/G]
TCAAGGCCAACTTGCTTCTTTCATCTCCACTGAACAGAGACCCTCAATGGTCATGCCACCGCTGACATCCATGTTCGCCATAGAATCAATGGTGACTTCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 0.60% | 3.66% | 19.30% | NA |
| All Indica | 2759 | 77.30% | 0.90% | 3.33% | 18.41% | NA |
| All Japonica | 1512 | 86.30% | 0.10% | 1.19% | 12.37% | NA |
| Aus | 269 | 6.30% | 0.00% | 20.45% | 73.23% | NA |
| Indica I | 595 | 98.30% | 0.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 71.00% | 3.40% | 5.59% | 20.00% | NA |
| Indica III | 913 | 64.60% | 0.30% | 3.40% | 31.65% | NA |
| Indica Intermediate | 786 | 80.00% | 0.80% | 3.18% | 16.03% | NA |
| Temperate Japonica | 767 | 77.40% | 0.10% | 1.96% | 20.47% | NA |
| Tropical Japonica | 504 | 95.20% | 0.20% | 0.40% | 4.17% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 4.17% | 9.38% | NA |
| Intermediate | 90 | 80.00% | 3.30% | 4.44% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415203314 | T -> C | LOC_Os04g26110.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.675; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0415203314 | T -> DEL | N | N | silent_mutation | Average:50.675; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415203314 | NA | 3.51E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 7.01E-07 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 4.64E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 3.17E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 4.39E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | 1.91E-06 | 2.07E-09 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 3.67E-07 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | 4.68E-08 | 4.68E-08 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 1.45E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 7.65E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203314 | NA | 2.79E-07 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |