\
| Variant ID: vg0415203123 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15203123 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGTGGTGATTAATTTGTGAGCATCACCAACGGCTTCCGTGAGCTGTTGGCAGCAGCACATGTGTGGGCAGTGGCATGCTAAGTGATCAAAGTGAGGCACT[A/G]
TCTCGAGTATGAGGTTGATGCTAGCAGTAGCTAATAAACCTGCAACAACAGGAGTGTGAGGATTGCACACCGTGGGGTTGGCGAGTGTGACGAAGTCACC
GGTGACTTCGTCACACTCGCCAACCCCACGGTGTGCAATCCTCACACTCCTGTTGTTGCAGGTTTATTAGCTACTGCTAGCATCAACCTCATACTCGAGA[T/C]
AGTGCCTCACTTTGATCACTTAGCATGCCACTGCCCACACATGTGCTGCTGCCAACAGCTCACGGAAGCCGTTGGTGATGCTCACAAATTAATCACCACC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 2.40% | 7.83% | 20.04% | NA |
| All Indica | 2759 | 75.00% | 0.60% | 5.94% | 18.52% | NA |
| All Japonica | 1512 | 69.70% | 5.70% | 8.86% | 15.74% | NA |
| Aus | 269 | 9.70% | 0.40% | 23.42% | 66.54% | NA |
| Indica I | 595 | 87.90% | 0.00% | 12.10% | 0.00% | NA |
| Indica II | 465 | 73.30% | 0.20% | 6.88% | 19.57% | NA |
| Indica III | 913 | 64.10% | 1.40% | 2.74% | 31.76% | NA |
| Indica Intermediate | 786 | 78.80% | 0.30% | 4.45% | 16.54% | NA |
| Temperate Japonica | 767 | 51.00% | 7.30% | 16.17% | 25.55% | NA |
| Tropical Japonica | 504 | 92.90% | 1.80% | 0.60% | 4.76% | NA |
| Japonica Intermediate | 241 | 80.90% | 8.70% | 2.90% | 7.47% | NA |
| VI/Aromatic | 96 | 81.20% | 8.30% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 76.70% | 3.30% | 7.78% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415203123 | A -> DEL | N | N | silent_mutation | Average:48.78; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg0415203123 | A -> G | LOC_Os04g26110.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.78; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415203123 | 9.04E-06 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | 2.69E-08 | NA | mr1203 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | NA | 8.92E-07 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | 2.20E-06 | NA | mr1395 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | NA | 4.78E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | NA | 5.66E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415203123 | NA | 3.46E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |