\
| Variant ID: vg0415198238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15198238 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCATTAGTGATAATTAATCACTAATTTTATTATTATACTGTTATTTCCGAAATTAATATTTTGACGCACCCTATTTCTTATAAAATAAAAAAAAGGTGTA[C/T]
AAAATATCATCGAACAAAATGCCCCCTCACCAAGTTAAATTCGAGCATGGAGCGGCTCGGAATTAACTTGGTGAAAATTTTCCATTTCCTGAGGAACAAT
ATTGTTCCTCAGGAAATGGAAAATTTTCACCAAGTTAATTCCGAGCCGCTCCATGCTCGAATTTAACTTGGTGAGGGGGCATTTTGTTCGATGATATTTT[G/A]
TACACCTTTTTTTTATTTTATAAGAAATAGGGTGCGTCAAAATATTAATTTCGGAAATAACAGTATAATAATAAAATTAGTGATTAATTATCACTAATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.50% | 12.80% | 2.94% | 8.84% | NA |
| All Indica | 2759 | 75.60% | 12.30% | 4.02% | 8.01% | NA |
| All Japonica | 1512 | 86.80% | 0.20% | 1.06% | 11.90% | NA |
| Aus | 269 | 2.60% | 91.40% | 2.97% | 2.97% | NA |
| Indica I | 595 | 90.10% | 9.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 71.20% | 22.40% | 4.09% | 2.37% | NA |
| Indica III | 913 | 65.00% | 9.60% | 7.89% | 17.52% | NA |
| Indica Intermediate | 786 | 79.80% | 11.50% | 2.54% | 6.23% | NA |
| Temperate Japonica | 767 | 76.00% | 0.10% | 1.96% | 21.90% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 87.50% | 5.20% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 83.30% | 10.00% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415198238 | C -> DEL | N | N | silent_mutation | Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0415198238 | C -> T | LOC_Os04g26100.1 | downstream_gene_variant ; 1125.0bp to feature; MODIFIER | silent_mutation | Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0415198238 | C -> T | LOC_Os04g26110.1 | downstream_gene_variant ; 4463.0bp to feature; MODIFIER | silent_mutation | Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0415198238 | C -> T | LOC_Os04g26100-LOC_Os04g26110 | intergenic_region ; MODIFIER | silent_mutation | Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415198238 | NA | 5.59E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 3.03E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 9.86E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 4.44E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 8.40E-07 | mr1482 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 5.47E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 3.60E-06 | mr1704 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 1.92E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 3.33E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 6.65E-08 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 9.60E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415198238 | NA | 6.64E-06 | mr1916_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |