\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415198238:

Variant ID: vg0415198238 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15198238
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATTAGTGATAATTAATCACTAATTTTATTATTATACTGTTATTTCCGAAATTAATATTTTGACGCACCCTATTTCTTATAAAATAAAAAAAAGGTGTA[C/T]
AAAATATCATCGAACAAAATGCCCCCTCACCAAGTTAAATTCGAGCATGGAGCGGCTCGGAATTAACTTGGTGAAAATTTTCCATTTCCTGAGGAACAAT

Reverse complement sequence

ATTGTTCCTCAGGAAATGGAAAATTTTCACCAAGTTAATTCCGAGCCGCTCCATGCTCGAATTTAACTTGGTGAGGGGGCATTTTGTTCGATGATATTTT[G/A]
TACACCTTTTTTTTATTTTATAAGAAATAGGGTGCGTCAAAATATTAATTTCGGAAATAACAGTATAATAATAAAATTAGTGATTAATTATCACTAATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.50% 12.80% 2.94% 8.84% NA
All Indica  2759 75.60% 12.30% 4.02% 8.01% NA
All Japonica  1512 86.80% 0.20% 1.06% 11.90% NA
Aus  269 2.60% 91.40% 2.97% 2.97% NA
Indica I  595 90.10% 9.70% 0.00% 0.17% NA
Indica II  465 71.20% 22.40% 4.09% 2.37% NA
Indica III  913 65.00% 9.60% 7.89% 17.52% NA
Indica Intermediate  786 79.80% 11.50% 2.54% 6.23% NA
Temperate Japonica  767 76.00% 0.10% 1.96% 21.90% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 95.90% 0.40% 0.41% 3.32% NA
VI/Aromatic  96 87.50% 5.20% 2.08% 5.21% NA
Intermediate  90 83.30% 10.00% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415198238 C -> DEL N N silent_mutation Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0415198238 C -> T LOC_Os04g26100.1 downstream_gene_variant ; 1125.0bp to feature; MODIFIER silent_mutation Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0415198238 C -> T LOC_Os04g26110.1 downstream_gene_variant ; 4463.0bp to feature; MODIFIER silent_mutation Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0415198238 C -> T LOC_Os04g26100-LOC_Os04g26110 intergenic_region ; MODIFIER silent_mutation Average:30.172; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415198238 NA 5.59E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 3.03E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 9.86E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 4.44E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 8.40E-07 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 5.47E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 3.60E-06 mr1704 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 1.92E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 3.33E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 6.65E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 9.60E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415198238 NA 6.64E-06 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251