\
| Variant ID: vg0415147115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15147115 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 295. )
TGATCATGGGTCTATTTTCTATGCTCAAAGACTGGACTATTTATTATTCCCCGTAAGGGTTATCAACTGAATACTTGCGCCAGTCGGGATTCAATTGTTA[C/T]
ATCTATTTTGGAGTATCCCAGAAGGGATAATCATTCAGATCAGAAGCTATTCATATGAGCTACATTTGGTCTATAATACCTGGAAGATCTATTACTCGGG
CCCGAGTAATAGATCTTCCAGGTATTATAGACCAAATGTAGCTCATATGAATAGCTTCTGATCTGAATGATTATCCCTTCTGGGATACTCCAAAATAGAT[G/A]
TAACAATTGAATCCCGACTGGCGCAAGTATTCAGTTGATAACCCTTACGGGGAATAATAAATAGTCCAGTCTTTGAGCATAGAAAATAGACCCATGATCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 0.10% | 8.48% | 4.49% | NA |
| All Indica | 2759 | 91.80% | 0.00% | 6.16% | 2.03% | NA |
| All Japonica | 1512 | 89.70% | 0.30% | 4.30% | 5.69% | NA |
| Aus | 269 | 14.50% | 0.40% | 59.48% | 25.65% | NA |
| Indica I | 595 | 96.80% | 0.00% | 0.50% | 2.69% | NA |
| Indica II | 465 | 88.20% | 0.20% | 6.88% | 4.73% | NA |
| Indica III | 913 | 91.10% | 0.00% | 8.65% | 0.22% | NA |
| Indica Intermediate | 786 | 90.80% | 0.00% | 7.12% | 2.04% | NA |
| Temperate Japonica | 767 | 82.10% | 0.50% | 8.08% | 9.26% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.60% | 1.59% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 6.67% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415147115 | C -> DEL | N | N | silent_mutation | Average:27.378; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147115 | C -> T | LOC_Os04g26030.1 | downstream_gene_variant ; 997.0bp to feature; MODIFIER | silent_mutation | Average:27.378; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147115 | C -> T | LOC_Os04g26040.1 | downstream_gene_variant ; 1537.0bp to feature; MODIFIER | silent_mutation | Average:27.378; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147115 | C -> T | LOC_Os04g26030-LOC_Os04g26040 | intergenic_region ; MODIFIER | silent_mutation | Average:27.378; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415147115 | 7.33E-06 | NA | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415147115 | 8.41E-06 | NA | mr1658 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415147115 | NA | 8.71E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |