\
| Variant ID: vg0415147095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15147095 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
ATATATGCAATATGAATTCGTGATCATGGGTCTATTTTCTATGCTCAAAGACTGGACTATTTATTATTCCCCGTAAGGGTTATCAACTGAATACTTGCGC[C/T]
AGTCGGGATTCAATTGTTACATCTATTTTGGAGTATCCCAGAAGGGATAATCATTCAGATCAGAAGCTATTCATATGAGCTACATTTGGTCTATAATACC
GGTATTATAGACCAAATGTAGCTCATATGAATAGCTTCTGATCTGAATGATTATCCCTTCTGGGATACTCCAAAATAGATGTAACAATTGAATCCCGACT[G/A]
GCGCAAGTATTCAGTTGATAACCCTTACGGGGAATAATAAATAGTCCAGTCTTTGAGCATAGAAAATAGACCCATGATCACGAATTCATATTGCATATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.60% | 3.10% | 10.01% | 5.27% | NA |
| All Indica | 2759 | 88.50% | 0.10% | 9.13% | 2.17% | NA |
| All Japonica | 1512 | 80.60% | 7.90% | 5.29% | 6.22% | NA |
| Aus | 269 | 12.60% | 4.50% | 48.70% | 34.20% | NA |
| Indica I | 595 | 87.90% | 0.00% | 10.08% | 2.02% | NA |
| Indica II | 465 | 86.90% | 0.00% | 7.53% | 5.59% | NA |
| Indica III | 913 | 89.40% | 0.00% | 9.75% | 0.88% | NA |
| Indica Intermediate | 786 | 89.10% | 0.50% | 8.65% | 1.78% | NA |
| Temperate Japonica | 767 | 67.10% | 13.20% | 8.47% | 11.21% | NA |
| Tropical Japonica | 504 | 96.80% | 0.60% | 1.39% | 1.19% | NA |
| Japonica Intermediate | 241 | 89.60% | 6.20% | 3.32% | 0.83% | NA |
| VI/Aromatic | 96 | 82.30% | 10.40% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 2.20% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415147095 | C -> DEL | N | N | silent_mutation | Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147095 | C -> T | LOC_Os04g26030.1 | downstream_gene_variant ; 977.0bp to feature; MODIFIER | silent_mutation | Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147095 | C -> T | LOC_Os04g26040.1 | downstream_gene_variant ; 1557.0bp to feature; MODIFIER | silent_mutation | Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0415147095 | C -> T | LOC_Os04g26030-LOC_Os04g26040 | intergenic_region ; MODIFIER | silent_mutation | Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415147095 | 8.70E-06 | NA | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415147095 | 3.46E-06 | NA | mr1658 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415147095 | NA | 3.15E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |