\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415147095:

Variant ID: vg0415147095 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15147095
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATGCAATATGAATTCGTGATCATGGGTCTATTTTCTATGCTCAAAGACTGGACTATTTATTATTCCCCGTAAGGGTTATCAACTGAATACTTGCGC[C/T]
AGTCGGGATTCAATTGTTACATCTATTTTGGAGTATCCCAGAAGGGATAATCATTCAGATCAGAAGCTATTCATATGAGCTACATTTGGTCTATAATACC

Reverse complement sequence

GGTATTATAGACCAAATGTAGCTCATATGAATAGCTTCTGATCTGAATGATTATCCCTTCTGGGATACTCCAAAATAGATGTAACAATTGAATCCCGACT[G/A]
GCGCAAGTATTCAGTTGATAACCCTTACGGGGAATAATAAATAGTCCAGTCTTTGAGCATAGAAAATAGACCCATGATCACGAATTCATATTGCATATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 3.10% 10.01% 5.27% NA
All Indica  2759 88.50% 0.10% 9.13% 2.17% NA
All Japonica  1512 80.60% 7.90% 5.29% 6.22% NA
Aus  269 12.60% 4.50% 48.70% 34.20% NA
Indica I  595 87.90% 0.00% 10.08% 2.02% NA
Indica II  465 86.90% 0.00% 7.53% 5.59% NA
Indica III  913 89.40% 0.00% 9.75% 0.88% NA
Indica Intermediate  786 89.10% 0.50% 8.65% 1.78% NA
Temperate Japonica  767 67.10% 13.20% 8.47% 11.21% NA
Tropical Japonica  504 96.80% 0.60% 1.39% 1.19% NA
Japonica Intermediate  241 89.60% 6.20% 3.32% 0.83% NA
VI/Aromatic  96 82.30% 10.40% 7.29% 0.00% NA
Intermediate  90 91.10% 2.20% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415147095 C -> DEL N N silent_mutation Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0415147095 C -> T LOC_Os04g26030.1 downstream_gene_variant ; 977.0bp to feature; MODIFIER silent_mutation Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0415147095 C -> T LOC_Os04g26040.1 downstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0415147095 C -> T LOC_Os04g26030-LOC_Os04g26040 intergenic_region ; MODIFIER silent_mutation Average:26.233; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415147095 8.70E-06 NA mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415147095 3.46E-06 NA mr1658 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415147095 NA 3.15E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251