\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415146457:

Variant ID: vg0415146457 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15146457
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.29, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTGACATCTCTGCTGTTGCTAATGGATGATTATGTTTTCGCCGACTTATTATTTCACCTTCACGGTTGACCTACTATGCAAATGCTGATGAGCGTCTT[T/C]
GTCATTATCATTGGTTGCGACACTGCTATTGACTGGATCGCCGACATCGTCATCTTCATCATGTCAGTTGCGTTTGTCGTCGCCGACTATTTTCTTCATC

Reverse complement sequence

GATGAAGAAAATAGTCGGCGACGACAAACGCAACTGACATGATGAAGATGACGATGTCGGCGATCCAGTCAATAGCAGTGTCGCAACCAATGATAATGAC[A/G]
AAGACGCTCATCAGCATTTGCATAGTAGGTCAACCGTGAAGGTGAAATAATAAGTCGGCGAAAACATAATCATCCATTAGCAACAGCAGAGATGTCAGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 2.30% 0.38% 1.95% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 86.10% 6.90% 0.93% 6.08% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 74.30% 12.30% 1.56% 11.86% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 0.00% 4.17% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415146457 T -> C LOC_Os04g26030.1 downstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0415146457 T -> C LOC_Os04g26040.1 downstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0415146457 T -> C LOC_Os04g26030-LOC_Os04g26040 intergenic_region ; MODIFIER silent_mutation Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N
vg0415146457 T -> DEL N N silent_mutation Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415146457 NA 9.13E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457 1.50E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457 NA 5.54E-07 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457 1.24E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415146457 NA 1.18E-08 mr1900 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251