\
| Variant ID: vg0415146457 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15146457 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.29, others allele: 0.00, population size: 195. )
CCCTGACATCTCTGCTGTTGCTAATGGATGATTATGTTTTCGCCGACTTATTATTTCACCTTCACGGTTGACCTACTATGCAAATGCTGATGAGCGTCTT[T/C]
GTCATTATCATTGGTTGCGACACTGCTATTGACTGGATCGCCGACATCGTCATCTTCATCATGTCAGTTGCGTTTGTCGTCGCCGACTATTTTCTTCATC
GATGAAGAAAATAGTCGGCGACGACAAACGCAACTGACATGATGAAGATGACGATGTCGGCGATCCAGTCAATAGCAGTGTCGCAACCAATGATAATGAC[A/G]
AAGACGCTCATCAGCATTTGCATAGTAGGTCAACCGTGAAGGTGAAATAATAAGTCGGCGAAAACATAATCATCCATTAGCAACAGCAGAGATGTCAGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 2.30% | 0.38% | 1.95% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.10% | 6.90% | 0.93% | 6.08% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.30% | 12.30% | 1.56% | 11.86% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415146457 | T -> C | LOC_Os04g26030.1 | downstream_gene_variant ; 339.0bp to feature; MODIFIER | silent_mutation | Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| vg0415146457 | T -> C | LOC_Os04g26040.1 | downstream_gene_variant ; 2195.0bp to feature; MODIFIER | silent_mutation | Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| vg0415146457 | T -> C | LOC_Os04g26030-LOC_Os04g26040 | intergenic_region ; MODIFIER | silent_mutation | Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| vg0415146457 | T -> DEL | N | N | silent_mutation | Average:34.19; most accessible tissue: Zhenshan97 young leaf, score: 53.969 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415146457 | NA | 9.13E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415146457 | 1.50E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415146457 | NA | 5.54E-07 | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415146457 | 1.24E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415146457 | NA | 1.18E-08 | mr1900 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |