\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415115564:

Variant ID: vg0415115564 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 15115564
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAGATGAAAAAATAGATGGGTATGAAGACAATGAATTTTATACAGGTTCAGGCCCTCTCAATGAGAAGTAATACCCTACTCCTGTCCAGAGATTGATC[C/T]
ACCGAGTGTGTTATTGATTGTATAATCTGGAAGAAAAGTTATGCCCCAAGAGTCATCCGGACCTCTCCTTATATAGTGAGAGGAGTCTGTATTACAACAT

Reverse complement sequence

ATGTTGTAATACAGACTCCTCTCACTATATAAGGAGAGGTCCGGATGACTCTTGGGGCATAACTTTTCTTCCAGATTATACAATCAATAACACACTCGGT[G/A]
GATCAATCTCTGGACAGGAGTAGGGTATTACTTCTCATTGAGAGGGCCTGAACCTGTATAAAATTCATTGTCTTCATACCCATCTATTTTTTCATCTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 5.50% 0.40% 11.17% NA
All Indica  2759 87.00% 0.40% 0.43% 12.18% NA
All Japonica  1512 71.80% 16.10% 0.46% 11.57% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.90% 0.20% 0.00% 14.96% NA
Indica II  465 92.50% 1.50% 0.22% 5.81% NA
Indica III  913 82.90% 0.00% 0.66% 16.43% NA
Indica Intermediate  786 90.20% 0.30% 0.64% 8.91% NA
Temperate Japonica  767 54.20% 29.60% 0.78% 15.38% NA
Tropical Japonica  504 93.10% 1.00% 0.20% 5.75% NA
Japonica Intermediate  241 83.40% 5.00% 0.00% 11.62% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 87.80% 7.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0415115564 C -> DEL N N silent_mutation Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0415115564 C -> T LOC_Os04g25980.1 downstream_gene_variant ; 4815.0bp to feature; MODIFIER silent_mutation Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0415115564 C -> T LOC_Os04g25970-LOC_Os04g25980 intergenic_region ; MODIFIER silent_mutation Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0415115564 6.32E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564 NA 8.43E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564 NA 2.66E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564 NA 5.35E-07 mr1521_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251