Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0415115564:

Variant ID: vg0415115564 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 15115564
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAAGATGAAAAAATAGATGGGTATGAAGACAATGAATTTTATACAGGTTCAGGCCCTCTCAATGAGAAGTAATACCCTACTCCTGTCCAGAGATTGATC[C/T]
ACCGAGTGTGTTATTGATTGTATAATCTGGAAGAAAAGTTATGCCCCAAGAGTCATCCGGACCTCTCCTTATATAGTGAGAGGAGTCTGTATTACAACAT

Reverse complement sequence

ATGTTGTAATACAGACTCCTCTCACTATATAAGGAGAGGTCCGGATGACTCTTGGGGCATAACTTTTCTTCCAGATTATACAATCAATAACACACTCGGT[G/A]
GATCAATCTCTGGACAGGAGTAGGGTATTACTTCTCATTGAGAGGGCCTGAACCTGTATAAAATTCATTGTCTTCATACCCATCTATTTTTTCATCTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	5.50%	0.40%	11.17%	NA
All Indica	2759	87.00%	0.40%	0.43%	12.18%	NA
All Japonica	1512	71.80%	16.10%	0.46%	11.57%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	84.90%	0.20%	0.00%	14.96%	NA
Indica II	465	92.50%	1.50%	0.22%	5.81%	NA
Indica III	913	82.90%	0.00%	0.66%	16.43%	NA
Indica Intermediate	786	90.20%	0.30%	0.64%	8.91%	NA
Temperate Japonica	767	54.20%	29.60%	0.78%	15.38%	NA
Tropical Japonica	504	93.10%	1.00%	0.20%	5.75%	NA
Japonica Intermediate	241	83.40%	5.00%	0.00%	11.62%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	13.54%	NA
Intermediate	90	87.80%	7.80%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415115564	C -> DEL	N	N	silent_mutation	Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0415115564	C -> T	LOC_Os04g25980.1	downstream_gene_variant ; 4815.0bp to feature; MODIFIER	silent_mutation	Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg0415115564	C -> T	LOC_Os04g25970-LOC_Os04g25980	intergenic_region ; MODIFIER	silent_mutation	Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415115564	6.32E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564	NA	8.43E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564	NA	2.66E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415115564	NA	5.35E-07	mr1521_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251