\
| Variant ID: vg0415115564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15115564 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCAAGATGAAAAAATAGATGGGTATGAAGACAATGAATTTTATACAGGTTCAGGCCCTCTCAATGAGAAGTAATACCCTACTCCTGTCCAGAGATTGATC[C/T]
ACCGAGTGTGTTATTGATTGTATAATCTGGAAGAAAAGTTATGCCCCAAGAGTCATCCGGACCTCTCCTTATATAGTGAGAGGAGTCTGTATTACAACAT
ATGTTGTAATACAGACTCCTCTCACTATATAAGGAGAGGTCCGGATGACTCTTGGGGCATAACTTTTCTTCCAGATTATACAATCAATAACACACTCGGT[G/A]
GATCAATCTCTGGACAGGAGTAGGGTATTACTTCTCATTGAGAGGGCCTGAACCTGTATAAAATTCATTGTCTTCATACCCATCTATTTTTTCATCTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 5.50% | 0.40% | 11.17% | NA |
| All Indica | 2759 | 87.00% | 0.40% | 0.43% | 12.18% | NA |
| All Japonica | 1512 | 71.80% | 16.10% | 0.46% | 11.57% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.90% | 0.20% | 0.00% | 14.96% | NA |
| Indica II | 465 | 92.50% | 1.50% | 0.22% | 5.81% | NA |
| Indica III | 913 | 82.90% | 0.00% | 0.66% | 16.43% | NA |
| Indica Intermediate | 786 | 90.20% | 0.30% | 0.64% | 8.91% | NA |
| Temperate Japonica | 767 | 54.20% | 29.60% | 0.78% | 15.38% | NA |
| Tropical Japonica | 504 | 93.10% | 1.00% | 0.20% | 5.75% | NA |
| Japonica Intermediate | 241 | 83.40% | 5.00% | 0.00% | 11.62% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415115564 | C -> DEL | N | N | silent_mutation | Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0415115564 | C -> T | LOC_Os04g25980.1 | downstream_gene_variant ; 4815.0bp to feature; MODIFIER | silent_mutation | Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0415115564 | C -> T | LOC_Os04g25970-LOC_Os04g25980 | intergenic_region ; MODIFIER | silent_mutation | Average:39.035; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415115564 | 6.32E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415115564 | NA | 8.43E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415115564 | NA | 2.66E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415115564 | NA | 5.35E-07 | mr1521_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |