\
| Variant ID: vg0415096885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15096885 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATGTTGCAAGGAGGCGACAACTTGGTTTTATAGAGATAACATGACGCGTGATCAGAATGCCTGCACGATCTCCACACCACGTAACCGAACCGGATAAGT[C/T]
ACGCATAACTTATTCGGACTCCACGCCACTTCATGCACCAGATTATTTGATGTATTTCCAAAATCTATGTTTACAAAACAAACACCGAATTTTACAACAA
TTGTTGTAAAATTCGGTGTTTGTTTTGTAAACATAGATTTTGGAAATACATCAAATAATCTGGTGCATGAAGTGGCGTGGAGTCCGAATAAGTTATGCGT[G/A]
ACTTATCCGGTTCGGTTACGTGGTGTGGAGATCGTGCAGGCATTCTGATCACGCGTCATGTTATCTCTATAAAACCAAGTTGTCGCCTCCTTGCAACATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 0.30% | 0.87% | 14.45% | NA |
| All Indica | 2759 | 88.10% | 0.00% | 0.40% | 11.45% | NA |
| All Japonica | 1512 | 74.30% | 1.00% | 1.92% | 22.75% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.70% | 0.00% | 0.84% | 15.46% | NA |
| Indica II | 465 | 96.10% | 0.00% | 0.22% | 3.66% | NA |
| Indica III | 913 | 83.60% | 0.00% | 0.55% | 15.88% | NA |
| Indica Intermediate | 786 | 92.10% | 0.00% | 0.00% | 7.89% | NA |
| Temperate Japonica | 767 | 59.20% | 1.60% | 3.39% | 35.85% | NA |
| Tropical Japonica | 504 | 93.10% | 0.00% | 0.00% | 6.94% | NA |
| Japonica Intermediate | 241 | 83.40% | 1.20% | 1.24% | 14.11% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 1.04% | 14.58% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415096885 | C -> DEL | N | N | silent_mutation | Average:35.8; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0415096885 | C -> T | LOC_Os04g25960.1 | upstream_gene_variant ; 1267.0bp to feature; MODIFIER | silent_mutation | Average:35.8; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0415096885 | C -> T | LOC_Os04g25950.1 | downstream_gene_variant ; 2203.0bp to feature; MODIFIER | silent_mutation | Average:35.8; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0415096885 | C -> T | LOC_Os04g25950-LOC_Os04g25960 | intergenic_region ; MODIFIER | silent_mutation | Average:35.8; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415096885 | 1.74E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415096885 | NA | 6.05E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415096885 | 1.96E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415096885 | NA | 6.28E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415096885 | 1.17E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415096885 | NA | 1.25E-09 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |