\
| Variant ID: vg0415051891 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 15051891 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATTTATAACTCTTTGATTTTTCACGCTTTATTGGAGATGAACAGGCGTCACGTTTAGGTGCTGATCGCCTGATTCCTGTGTTGCATCCAACTTTTGTG[C/A]
CATTCTTGTCATTCATTGTTAGGCGCAGTTTAGTTTAGCTCGTATGGTTCATCCATTTTTAAGCATATAAGCTTCTTTTAAGTCAAAATTTTACTTAATC
GATTAAGTAAAATTTTGACTTAAAAGAAGCTTATATGCTTAAAAATGGATGAACCATACGAGCTAAACTAAACTGCGCCTAACAATGAATGACAAGAATG[G/T]
CACAAAAGTTGGATGCAACACAGGAATCAGGCGATCAGCACCTAAACGTGACGCCTGTTCATCTCCAATAAAGCGTGAAAAATCAAAGAGTTATAAATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 22.10% | 8.38% | 11.96% | NA |
| All Indica | 2759 | 51.80% | 26.10% | 10.80% | 11.27% | NA |
| All Japonica | 1512 | 74.80% | 3.80% | 5.42% | 15.94% | NA |
| Aus | 269 | 5.90% | 92.60% | 1.12% | 0.37% | NA |
| Indica I | 595 | 58.00% | 24.00% | 10.08% | 7.90% | NA |
| Indica II | 465 | 53.80% | 24.70% | 13.98% | 7.53% | NA |
| Indica III | 913 | 42.60% | 31.20% | 10.51% | 15.66% | NA |
| Indica Intermediate | 786 | 56.60% | 22.60% | 9.80% | 10.94% | NA |
| Temperate Japonica | 767 | 65.70% | 4.40% | 7.82% | 22.03% | NA |
| Tropical Japonica | 504 | 84.30% | 2.00% | 3.17% | 10.52% | NA |
| Japonica Intermediate | 241 | 83.80% | 5.80% | 2.49% | 7.88% | NA |
| VI/Aromatic | 96 | 80.20% | 7.30% | 3.12% | 9.38% | NA |
| Intermediate | 90 | 75.60% | 10.00% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0415051891 | C -> DEL | N | N | silent_mutation | Average:48.971; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0415051891 | C -> A | LOC_Os04g25890.1 | downstream_gene_variant ; 933.0bp to feature; MODIFIER | silent_mutation | Average:48.971; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| vg0415051891 | C -> A | LOC_Os04g25880-LOC_Os04g25890 | intergenic_region ; MODIFIER | silent_mutation | Average:48.971; most accessible tissue: Zhenshan97 flower, score: 62.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0415051891 | 9.91E-07 | NA | mr1946_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415051891 | 4.22E-06 | 2.50E-07 | mr1946_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415051891 | 9.91E-07 | NA | mr1948_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0415051891 | 4.22E-06 | 2.50E-07 | mr1948_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |