RiceVarMap2

Detailed information for vg0415024546:

Variant ID: vg0415024546 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 15024546

Reference Allele: A

Alternative Allele: G

Primary Allele: A

Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTGTAATTTTTTAATTCATGTTTTCATGGGTCTTCACTTCATTGAAGGTTATAAATGTCATGTTCAGATTGTAGCCAAAATAACCTTATCAAAGTTTG[A/G]
ACGAGATTGACAAGATTTTTTATGTTTTTACCAGAGTTTTGGTAAAAAAAAAACTAAATAGATGTATGTATTTAGCAATTTTACTAAAAAAAATAGTATA

Reverse complement sequence

TATACTATTTTTTTTAGTAAAATTGCTAAATACATACATCTATTTAGTTTTTTTTTTACCAAAACTCTGGTAAAAACATAAAAAATCTTGTCAATCTCGT[T/C]
CAAACTTTGATAAGGTTATTTTGGCTACAATCTGAACATGACATTTATAACCTTCAATGAAGTGAAGACCCATGAAAACATGAATTAAAAAATTACAAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	3.20%	17.05%	8.15%	NA
All Indica	2759	74.10%	5.10%	18.16%	2.65%	NA
All Japonica	1512	75.40%	0.90%	6.88%	16.87%	NA
Aus	269	10.40%	0.00%	71.75%	17.84%	NA
Indica I	595	72.40%	15.60%	11.43%	0.50%	NA
Indica II	465	76.80%	1.10%	20.00%	2.15%	NA
Indica III	913	70.90%	1.50%	22.23%	5.37%	NA
Indica Intermediate	786	77.60%	3.60%	17.43%	1.40%	NA
Temperate Japonica	767	64.10%	0.70%	6.26%	28.94%	NA
Tropical Japonica	504	87.70%	1.20%	8.93%	2.18%	NA
Japonica Intermediate	241	85.50%	0.80%	4.56%	9.13%	NA
VI/Aromatic	96	92.70%	0.00%	3.12%	4.17%	NA
Intermediate	90	88.90%	0.00%	5.56%	5.56%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0415024546	A -> DEL	N	N	silent_mutation	Average:23.739; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0415024546	A -> G	LOC_Os04g25840.1	upstream_gene_variant ; 885.0bp to feature; MODIFIER	silent_mutation	Average:23.739; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0415024546	A -> G	LOC_Os04g25830-LOC_Os04g25840	intergenic_region ; MODIFIER	silent_mutation	Average:23.739; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0415024546	NA	2.65E-06	mr1120	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0415024546	NA	7.36E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0415024546:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact