\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414937528:

Variant ID: vg0414937528 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14937528
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGTCGTCTTCCCGGTTTATACCACGGTGCCGATCTCGACTGGTCCATCAATGACCGGAAGCGAGAACGCCGTGGCTACAACCCCGGACGACTCCATGT[C/T]
GAAGGATCCTCCCGCAGAAGTGGAGAATGGAACGTCGACGACATCCAAGCCCGAGGAGGATCCTGGTGCGGTCAAATCTTGTCCTTCCGATGAGTGTCAC

Reverse complement sequence

GTGACACTCATCGGAAGGACAAGATTTGACCGCACCAGGATCCTCCTCGGGCTTGGATGTCGTCGACGTTCCATTCTCCACTTCTGCGGGAGGATCCTTC[G/A]
ACATGGAGTCGTCCGGGGTTGTAGCCACGGCGTTCTCGCTTCCGGTCATTGATGGACCAGTCGAGATCGGCACCGTGGTATAAACCGGGAAGACGACACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 12.50% 2.58% 5.44% NA
All Indica  2759 78.60% 12.60% 3.08% 5.73% NA
All Japonica  1512 93.20% 0.20% 0.40% 6.22% NA
Aus  269 4.50% 85.10% 10.04% 0.37% NA
Indica I  595 93.90% 0.20% 0.00% 5.88% NA
Indica II  465 68.60% 22.20% 6.02% 3.23% NA
Indica III  913 71.50% 17.30% 4.27% 6.90% NA
Indica Intermediate  786 81.20% 10.80% 2.29% 5.73% NA
Temperate Japonica  767 88.30% 0.10% 0.65% 10.95% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 96.70% 0.40% 0.41% 2.49% NA
VI/Aromatic  96 89.60% 6.20% 1.04% 3.12% NA
Intermediate  90 88.90% 6.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414937528 C -> DEL N N silent_mutation Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0414937528 C -> T LOC_Os04g25750.1 upstream_gene_variant ; 366.0bp to feature; MODIFIER silent_mutation Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0414937528 C -> T LOC_Os04g25760.1 upstream_gene_variant ; 3022.0bp to feature; MODIFIER silent_mutation Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0414937528 C -> T LOC_Os04g25770.1 downstream_gene_variant ; 4107.0bp to feature; MODIFIER silent_mutation Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N
vg0414937528 C -> T LOC_Os04g25740-LOC_Os04g25750 intergenic_region ; MODIFIER silent_mutation Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414937528 NA 2.25E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 5.23E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 4.95E-12 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 1.10E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 7.56E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 2.08E-12 mr1722 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 7.10E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 1.55E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 6.89E-09 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 2.21E-07 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 6.80E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 2.47E-10 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414937528 NA 4.80E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251