\
| Variant ID: vg0414937528 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14937528 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTGTCGTCTTCCCGGTTTATACCACGGTGCCGATCTCGACTGGTCCATCAATGACCGGAAGCGAGAACGCCGTGGCTACAACCCCGGACGACTCCATGT[C/T]
GAAGGATCCTCCCGCAGAAGTGGAGAATGGAACGTCGACGACATCCAAGCCCGAGGAGGATCCTGGTGCGGTCAAATCTTGTCCTTCCGATGAGTGTCAC
GTGACACTCATCGGAAGGACAAGATTTGACCGCACCAGGATCCTCCTCGGGCTTGGATGTCGTCGACGTTCCATTCTCCACTTCTGCGGGAGGATCCTTC[G/A]
ACATGGAGTCGTCCGGGGTTGTAGCCACGGCGTTCTCGCTTCCGGTCATTGATGGACCAGTCGAGATCGGCACCGTGGTATAAACCGGGAAGACGACACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.50% | 12.50% | 2.58% | 5.44% | NA |
| All Indica | 2759 | 78.60% | 12.60% | 3.08% | 5.73% | NA |
| All Japonica | 1512 | 93.20% | 0.20% | 0.40% | 6.22% | NA |
| Aus | 269 | 4.50% | 85.10% | 10.04% | 0.37% | NA |
| Indica I | 595 | 93.90% | 0.20% | 0.00% | 5.88% | NA |
| Indica II | 465 | 68.60% | 22.20% | 6.02% | 3.23% | NA |
| Indica III | 913 | 71.50% | 17.30% | 4.27% | 6.90% | NA |
| Indica Intermediate | 786 | 81.20% | 10.80% | 2.29% | 5.73% | NA |
| Temperate Japonica | 767 | 88.30% | 0.10% | 0.65% | 10.95% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.40% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 89.60% | 6.20% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 88.90% | 6.70% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414937528 | C -> DEL | N | N | silent_mutation | Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0414937528 | C -> T | LOC_Os04g25750.1 | upstream_gene_variant ; 366.0bp to feature; MODIFIER | silent_mutation | Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0414937528 | C -> T | LOC_Os04g25760.1 | upstream_gene_variant ; 3022.0bp to feature; MODIFIER | silent_mutation | Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0414937528 | C -> T | LOC_Os04g25770.1 | downstream_gene_variant ; 4107.0bp to feature; MODIFIER | silent_mutation | Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg0414937528 | C -> T | LOC_Os04g25740-LOC_Os04g25750 | intergenic_region ; MODIFIER | silent_mutation | Average:44.52; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414937528 | NA | 2.25E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 5.23E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 4.95E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 1.10E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 7.56E-06 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 2.08E-12 | mr1722 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 7.10E-06 | mr1749 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 1.55E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 6.89E-09 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 2.21E-07 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 6.80E-08 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 2.47E-10 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414937528 | NA | 4.80E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |