\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414877699:

Variant ID: vg0414877699 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 14877699
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTAACCACCTTATAATTCTCCAACTACCCCTATTTAATGAGACTTATTTAATGAGGGCAAAATACCCCTTGTTGGGCTTCTTAGTATTTTTTTCATTC[C/G,T]
TCCTTATTTCCTATAAAATTATATGATCCATTTTAGGCAGAAGATAGTAATTAAAAAGAGCTTAATTCGTAGAAGGATTTATTTGTACCTTTCTGGATTG

Reverse complement sequence

CAATCCAGAAAGGTACAAATAAATCCTTCTACGAATTAAGCTCTTTTTAATTACTATCTTCTGCCTAAAATGGATCATATAATTTTATAGGAAATAAGGA[G/C,A]
GAATGAAAAAAATACTAAGAAGCCCAACAAGGGGTATTTTGCCCTCATTAAATAAGTCTCATTAAATAGGGGTAGTTGGAGAATTATAAGGTGGTTAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 1.10% 1.21% 2.50% G: 0.02%
All Indica  2759 99.40% 0.00% 0.07% 0.51% NA
All Japonica  1512 86.40% 3.20% 3.64% 6.68% G: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 0.00% 0.34% 1.85% NA
Indica II  465 99.60% 0.00% 0.00% 0.43% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 76.40% 5.90% 6.65% 10.95% G: 0.13%
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 91.30% 0.80% 1.66% 6.22% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0414877699 C -> DEL N N silent_mutation Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0414877699 C -> G LOC_Os04g25660.1 downstream_gene_variant ; 4992.0bp to feature; MODIFIER silent_mutation Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0414877699 C -> G LOC_Os04g25660-LOC_Os04g25670 intergenic_region ; MODIFIER silent_mutation Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0414877699 C -> T LOC_Os04g25660.1 downstream_gene_variant ; 4992.0bp to feature; MODIFIER silent_mutation Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0414877699 C -> T LOC_Os04g25660-LOC_Os04g25670 intergenic_region ; MODIFIER silent_mutation Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0414877699 NA 4.39E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414877699 1.81E-06 1.81E-06 mr1525 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414877699 NA 3.51E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251