\
| Variant ID: vg0414877699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14877699 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTTAACCACCTTATAATTCTCCAACTACCCCTATTTAATGAGACTTATTTAATGAGGGCAAAATACCCCTTGTTGGGCTTCTTAGTATTTTTTTCATTC[C/G,T]
TCCTTATTTCCTATAAAATTATATGATCCATTTTAGGCAGAAGATAGTAATTAAAAAGAGCTTAATTCGTAGAAGGATTTATTTGTACCTTTCTGGATTG
CAATCCAGAAAGGTACAAATAAATCCTTCTACGAATTAAGCTCTTTTTAATTACTATCTTCTGCCTAAAATGGATCATATAATTTTATAGGAAATAAGGA[G/C,A]
GAATGAAAAAAATACTAAGAAGCCCAACAAGGGGTATTTTGCCCTCATTAAATAAGTCTCATTAAATAGGGGTAGTTGGAGAATTATAAGGTGGTTAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 1.10% | 1.21% | 2.50% | G: 0.02% |
| All Indica | 2759 | 99.40% | 0.00% | 0.07% | 0.51% | NA |
| All Japonica | 1512 | 86.40% | 3.20% | 3.64% | 6.68% | G: 0.07% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 0.00% | 0.34% | 1.85% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 76.40% | 5.90% | 6.65% | 10.95% | G: 0.13% |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 91.30% | 0.80% | 1.66% | 6.22% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414877699 | C -> DEL | N | N | silent_mutation | Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| vg0414877699 | C -> G | LOC_Os04g25660.1 | downstream_gene_variant ; 4992.0bp to feature; MODIFIER | silent_mutation | Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| vg0414877699 | C -> G | LOC_Os04g25660-LOC_Os04g25670 | intergenic_region ; MODIFIER | silent_mutation | Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| vg0414877699 | C -> T | LOC_Os04g25660.1 | downstream_gene_variant ; 4992.0bp to feature; MODIFIER | silent_mutation | Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| vg0414877699 | C -> T | LOC_Os04g25660-LOC_Os04g25670 | intergenic_region ; MODIFIER | silent_mutation | Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414877699 | NA | 4.39E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414877699 | 1.81E-06 | 1.81E-06 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414877699 | NA | 3.51E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |