RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0414877699:

Variant ID: vg0414877699 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14877699
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTAACCACCTTATAATTCTCCAACTACCCCTATTTAATGAGACTTATTTAATGAGGGCAAAATACCCCTTGTTGGGCTTCTTAGTATTTTTTTCATTC[C/G,T]
TCCTTATTTCCTATAAAATTATATGATCCATTTTAGGCAGAAGATAGTAATTAAAAAGAGCTTAATTCGTAGAAGGATTTATTTGTACCTTTCTGGATTG

Reverse complement sequence

CAATCCAGAAAGGTACAAATAAATCCTTCTACGAATTAAGCTCTTTTTAATTACTATCTTCTGCCTAAAATGGATCATATAATTTTATAGGAAATAAGGA[G/C,A]
GAATGAAAAAAATACTAAGAAGCCCAACAAGGGGTATTTTGCCCTCATTAAATAAGTCTCATTAAATAGGGGTAGTTGGAGAATTATAAGGTGGTTAAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	1.10%	1.21%	2.50%	G: 0.02%
All Indica	2759	99.40%	0.00%	0.07%	0.51%	NA
All Japonica	1512	86.40%	3.20%	3.64%	6.68%	G: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.80%	0.00%	0.34%	1.85%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	76.40%	5.90%	6.65%	10.95%	G: 0.13%
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	91.30%	0.80%	1.66%	6.22%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	97.80%	0.00%	0.00%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414877699	C -> DEL	N	N	silent_mutation	Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0414877699	C -> G	LOC_Os04g25660.1	downstream_gene_variant ; 4992.0bp to feature; MODIFIER	silent_mutation	Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0414877699	C -> G	LOC_Os04g25660-LOC_Os04g25670	intergenic_region ; MODIFIER	silent_mutation	Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0414877699	C -> T	LOC_Os04g25660.1	downstream_gene_variant ; 4992.0bp to feature; MODIFIER	silent_mutation	Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0414877699	C -> T	LOC_Os04g25660-LOC_Os04g25670	intergenic_region ; MODIFIER	silent_mutation	Average:50.299; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414877699	NA	4.39E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414877699	1.81E-06	1.81E-06	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414877699	NA	3.51E-06	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0414877699:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact