Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0414793750:

Variant ID: vg0414793750 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 14793750
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

AATAGCCGTAACACACACCACACCCCTTTTATTTGCCAAAAAGCACAAGTTACAGATAAATTCCATTGCCCGCCAAAAGGCATTCGGACTTTACATCCGA[C/T]
TCATTAACAAAAGCAATCCTCAAATGGCGAAGGACTACCCACTTGAGCATCTTTTTCATCGCTAGTTGTTAGATCAACACAAAAAATTTAGCGGTGAAGA

Reverse complement sequence

TCTTCACCGCTAAATTTTTTGTGTTGATCTAACAACTAGCGATGAAAAAGATGCTCAAGTGGGTAGTCCTTCGCCATTTGAGGATTGCTTTTGTTAATGA[G/A]
TCGGATGTAAAGTCCGAATGCCTTTTGGCGGGCAATGGAATTTATCTGTAACTTGTGCTTTTTGGCAAATAAAAGGGGTGTGGTGTGTGTTACGGCTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	19.20%	5.01%	0.70%	NA
All Indica	2759	79.90%	16.60%	3.48%	0.00%	NA
All Japonica	1512	78.10%	10.70%	8.99%	2.18%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	90.10%	9.60%	0.34%	0.00%	NA
Indica II	465	66.90%	26.70%	6.45%	0.00%	NA
Indica III	913	77.40%	17.50%	5.04%	0.00%	NA
Indica Intermediate	786	82.70%	15.00%	2.29%	0.00%	NA
Temperate Japonica	767	59.70%	19.70%	16.56%	4.04%	NA
Tropical Japonica	504	98.80%	0.80%	0.40%	0.00%	NA
Japonica Intermediate	241	93.40%	2.90%	2.90%	0.83%	NA
VI/Aromatic	96	83.30%	15.60%	1.04%	0.00%	NA
Intermediate	90	82.20%	13.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0414793750	C -> DEL	N	N	silent_mutation	Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0414793750	C -> T	LOC_Os04g25499.1	upstream_gene_variant ; 1471.0bp to feature; MODIFIER	silent_mutation	Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0414793750	C -> T	LOC_Os04g25510.1	upstream_gene_variant ; 1501.0bp to feature; MODIFIER	silent_mutation	Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0414793750	C -> T	LOC_Os04g25490.1	downstream_gene_variant ; 3841.0bp to feature; MODIFIER	silent_mutation	Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N
vg0414793750	C -> T	LOC_Os04g25499-LOC_Os04g25510	intergenic_region ; MODIFIER	silent_mutation	Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0414793750	NA	8.36E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	2.17E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	1.78E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	3.81E-06	mr1589	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	1.47E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	2.22E-06	1.78E-09	mr1877	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	3.50E-06	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0414793750	NA	9.18E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251