\
| Variant ID: vg0414793750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 14793750 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 191. )
AATAGCCGTAACACACACCACACCCCTTTTATTTGCCAAAAAGCACAAGTTACAGATAAATTCCATTGCCCGCCAAAAGGCATTCGGACTTTACATCCGA[C/T]
TCATTAACAAAAGCAATCCTCAAATGGCGAAGGACTACCCACTTGAGCATCTTTTTCATCGCTAGTTGTTAGATCAACACAAAAAATTTAGCGGTGAAGA
TCTTCACCGCTAAATTTTTTGTGTTGATCTAACAACTAGCGATGAAAAAGATGCTCAAGTGGGTAGTCCTTCGCCATTTGAGGATTGCTTTTGTTAATGA[G/A]
TCGGATGTAAAGTCCGAATGCCTTTTGGCGGGCAATGGAATTTATCTGTAACTTGTGCTTTTTGGCAAATAAAAGGGGTGTGGTGTGTGTTACGGCTATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 19.20% | 5.01% | 0.70% | NA |
| All Indica | 2759 | 79.90% | 16.60% | 3.48% | 0.00% | NA |
| All Japonica | 1512 | 78.10% | 10.70% | 8.99% | 2.18% | NA |
| Aus | 269 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.10% | 9.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 66.90% | 26.70% | 6.45% | 0.00% | NA |
| Indica III | 913 | 77.40% | 17.50% | 5.04% | 0.00% | NA |
| Indica Intermediate | 786 | 82.70% | 15.00% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 59.70% | 19.70% | 16.56% | 4.04% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 2.90% | 2.90% | 0.83% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0414793750 | C -> DEL | N | N | silent_mutation | Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0414793750 | C -> T | LOC_Os04g25499.1 | upstream_gene_variant ; 1471.0bp to feature; MODIFIER | silent_mutation | Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0414793750 | C -> T | LOC_Os04g25510.1 | upstream_gene_variant ; 1501.0bp to feature; MODIFIER | silent_mutation | Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0414793750 | C -> T | LOC_Os04g25490.1 | downstream_gene_variant ; 3841.0bp to feature; MODIFIER | silent_mutation | Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| vg0414793750 | C -> T | LOC_Os04g25499-LOC_Os04g25510 | intergenic_region ; MODIFIER | silent_mutation | Average:32.804; most accessible tissue: Minghui63 young leaf, score: 50.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0414793750 | NA | 8.36E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 2.17E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 1.78E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 3.81E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 1.47E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | 2.22E-06 | 1.78E-09 | mr1877 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 3.50E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0414793750 | NA | 9.18E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |